1. A 4.1 SL Evolution.pptx for IB Biology

IB BIOLOGY

1. A 4.1 Evolution & Speciation “There is overwhelming evidence for the evolution of life on Earth”

2. A4.1.1 Evolution as change in the heritable characteristics of a population This definition helps to distinguish Darwinian evolution from Lamarckism. Acquired changes that are not genetic in origin are not regarded as evolution. A4.1.2 Evidence for evolution from base sequences in DNA or RNA and amino acid sequences in proteins Sequence data gives powerful evidence of common ancestry. A4.1.3 Evidence for evolution from selective breeding of domesticated animals and crop plants Variation between different domesticated animal breeds and varieties of crop plant, and between them and the original wild species, shows how rapidly evolutionary changes can occur. A4.1.4 Evidence for evolution from homologous structures Include the example of pentadactyl limbs. A4.1.5 Convergent evolution as the origin of analogous structures Students should understand that analogous structures have the same function but different evolutionary origins. Students should know at least one example of analogous features. A4.1.6 Speciation by splitting of pre-existing species Students should appreciate that this is the only way in which new species have appeared. Students should also understand that speciation increases the total number of species on Earth, and extinction decreases it. Students should also understand that gradual evolutionary change in a species is not speciation. A4.1.7 Roles of reproductive isolation and differential selection in speciation Include geographical isolation as a means of achieving reproductive isolation. Use the separation of bonobos and common chimpanzees by the Congo River as a specific example of divergence due to differential selection. Learning Objectives

3. Evolution as change in the heritable characteristics Is the directional growth of this wind-swept tree affected by a heritable characteristic? https://www.pinterest.ch/pin/315674255100550764/

4. Evolution as change in the heritable characteristics Characteristics of populations are changing over time, but these characteristics must be heritable and not aquired – traits that are inherited by offspring from parents. The theory of evolution by natural selection was coined by Charles Darwin and is now well understood. https://www.britannica.com/biography/Charles-Darwin

5. Evolution as change in the heritable characteristics https://www.chegg.com/learn/topic/mutations-and-lamarcks-theory Before Charles Darwin published his book “On the Origins of Species” the leading theory for evolution was based on inheritance of aquired charcteristics, proposed by Jean-Baptiste Lamarck. This theory was soon refuted. According to Lamarck, the giraffe got its long neck because its ancestors stretched theirs to eat leaves that were just out of reach. This stretching of the neck was passed on to their offspring, over generations, until it reached its current length.

6. Evolution as change in the heritable characteristics In contrast to Lamarck’s ideas on evolution, Darwin argues that evolution & variation within a population occurs due to selection pressures , which enables orgaisms that are better adapted to the environment to survive and pass on this advantage to future generations.

7. Evolution as change in the heritable characteristics Use the two images below and knowledge from before to desribe how the theories of evolution by Lamarck and Darwin were diff e rent: https://ib.bioninja.com.au/standard-level/topic-5-evolution-and-biodi/52-natural-selection/theories-of-evolution.html

8. Look at these made up base sequences: AATCGCCGAAGCTTTGCATTTGCAA AATCGCAGAAGCTTTGCATTTTCAA AATCAACGAAGCTATGCATTTGCAA AATCACCGAAGCTATGCATTTGCAA Which species are most closely related? A T A A A A A = Differences when compared to species 1. 3 & 4 have only one base pair difference and so therefore are the closest relatives 1 & 3 have the most differences (3bp) so are the most distantly related. Evidence for evolution from base sequences in DNA or RNA

9. Evidence for evolution from base sequences in DNA or RNA With evolution being a change in heritable characteristics, we can observe changes in the base sequence of the DNA or RNA whenever evolution occurs. Comparing base sequences of the same gene in different species sheds light on potential evolutionary relationships. https://evolution.berkeley.edu/why-the-eye/surprising-similarity/

10. http:// www.mpietrangelo.com / hbio /unit/14_evolutionary_history/Chapter_15/ B_Jpegs_of_Art_and_Photos /15_Labeled_Art_and_Photos/15_12_MolluscEyes-L.jpg Evidence for evolution from base sequences in DNA or RNA The original Pax gene which is responsible for eye-development and the eye-building genes of all the different animal lineages probably evolved more than 500 million years ago. As these descendent lineages further evolved, the basic eye-building gene was modified in different ways in the different lineages, giving rise to the diversity seen in modern animals. By comparing gene sequences which control eye-development ( Pax6 ) in different species, conclusions about the evolutionary development of vision can be made.

11. http:// evolution.berkeley.edu /admin/media/3/27956_evo_resources_resource_image_364_original.gif Selective breeding is a form of selection in which humans actively choose which traits should be passed onto offspring Evidence for evolution from selective breeding By repeatedly (and artificially) selecting and breeding individuals which are most suited to human uses different varieties can be created over a relatively short period of time.

12. https://www.nsf.gov/news/mmg/media/images/corn-and-teosinte_h1.jpg Evidence for evolution from selective breeding The tassels and seeds of a wild grass (Teosinte), became the male tassels and female ears of modern corn, which has been selected for stalk and seed size, as well as chemical and oil content, and color.

13. http:// www.agmrc.org /media/ cms /sweet_corn_pic_7C4E17FD8CCFA.jpg Evidence for evolution from selective breeding https://kaiserscience.wordpress.com/2017/03/12/evolution-of-cereals-and-grasses/ Wheat arose by natural crossings from various wild wheats around 8000 years ago in the Middle East, and already before that through hybridization.

14. http:// cdn.firstwefeast.com /assets/2014/10/giant_chickens-0.jpg If an animal posses a characteristic that is considered useful or valuable then this animal is selected for breeding. The hope then is that this characteristic will be present in the next generation and at a higher frequency than before. In subsequent generations it may even then be possible to select from an even more advantageous characteristic. Evidence for evolution from selective breeding

15. Selective breeding provides evidence that selection can cause evolution, on short geologic time scale . It does not prove that evolution of species is occurring naturally but gives evidence that species can evolve rapidly. http:// www.wisdompanel.com /assets/1/7/ MainFCKEditorDimension / History_Chart.png Most breeds are clearly related to wild species and in many cases can still interbreed with them. Evidence for evolution from selective breeding

16. https:// upload.wikimedia.org / wikipedia /commons/0/0d/ Aurochs_reconstruction.jpg Belgium blue cattle http://cache1.asset-cache.net/ gc /519627431-belgian-blue-bull-isolated-on-white-gettyimages.jpg?v=1&c= IWSAsset&k =2&d=t8slg4VjrRY0t18DhsLejxWa34c%2BsS3SFoEh0VhxfetzhEQE3CfNNsQQNwdA%2FG9O Evidence for evolution from selective breeding Modern breeds of lifestock can be compared with the wild species that they most resemble – often the differences are huge. Aurochs

17. Evidence for evolution from homologous structures The evolutionary explanation of structures that have similar function, but different origins is called convergent evolution . Structures which have similar anatomy and carry out different functions are often due to development from a common ancestor. This is referred to as divergent evolution . Evolution can occur along different pathways and structural analysis in addition to genetic sequencing provides evidence for the development.

18. Evidence for evolution from homologous structures What do you notice about the limbs of these animals?

19. Limbs of vertebrates are strikingly similar, despite being used in different ways. These structural similarities in homologous structures have evolved from a common ancestor and are therefore evidence for divergent evolution . They have similar or the same bones in the same relative positions, but they have become different because they perform different functions due to different selection pressures (adaptive radiation). Evidence for evolution from homologous structures

20. Evidence for evolution from homologous structures The classic example of homologous structures is the pentadactyl limb of the vertebrate. In each example the bones are modified and adapted to the locomotion of the animal. Humerus Radius Ulna Carpals https://classnotes.gidemy.com/topic/the-pentadactyl-limb/ phalanges

21. The image shows the skeletons of at least one example of each of the four vertebrates classes that have limbs: amphibians , reptiles , birds and mammals . Each of them is differently adapted to their method of locomotion. Penguin Evidence for evolution from homologous structures Bone structure Forelimb Hindlimb single bone in the proximal part humerus femur two bones in the distal part radius & ulna tibia & fibula wrist and ankle bones carpals tarsals series of bones in each of five digits metacarpals and phalanges metatarsals and phalanges Use their hind limbs for walking and their forelimbs for simming Crocodiles walk or crawl on land and use their webbed hind limbs for swimming. Echnidas use all four limbs for walking and also use their forelimbs for digging. Frogs use all four limbs for walking and their hindlimbs for jumping.

22. Choose a different colour for each type of bone in a pentadactyl limb, then colour the diagrams to identify the bones. How is each limb used? What features of the bones in each limb make it well adapted to its use? What could have been the selection pressure to cause the evolutionary development by adaptive radiation? Evidence for evolution from homologous structures

23. http:// i.livescience.com /images/ i /000/037/144/original/ostrich.jpg?1361827430 https ://c1.staticflickr.com/3/2200/2213975391_a578a0b30f.jpg Strong evidence for common descent also comes from vestigial structures which are rudimentary body parts that are smaller and simpler in structure than corresponding parts in the ancestral species. The existence of vestigial organs can be explained in terms of changes in the environment or modes of life in a species. Flightless birds (emu, ostrich,…) Eyes of cave fish or salamanders ( olm ) Appendix in humans, ear muscles, coccyx bone, embryonic gill slits… Pelvis and thigh bone in the body wall of whales and snakes Evidence for evolution from homologous structures

24. http:// krisallegra.blogspot.co.at /2012/06/homologous-structures-bats-wing- helping.html Analogous structures have similar form and function due to convergent evolution but have not developed from a common ancestor and therefore have different evolutionary origins. Convergent evolution as the origin of analogous structures

25. Birds…. http:// www.wallpapershighd.com / wp -content/uploads/2014/05/image-bird-flying-7.jpg ….birds… Lady bugs Convergent evolution as the origin of analogous structures

26. For this reason, the morphology (form and structure) of organisms is now rarely used for identifying members of a clade and evidence from base or amino acid sequences is trusted more. http:// loveyourchaos.tumblr.com /post/1420125252 ….and bats all have wings for flight that evolved independently Problems in distinguishing between homologous and analogous structures have sometimes led to mistakes in classification in the past. Convergent evolution as the origin of analogous structures

27. Convergent evolution as the origin of analogous structures

28. http:// earthwatch.org /expeditions/ darwins -finches-and-natural-selection-in-the- galapagos Speciation is when species are become different after having been separated from each other for an extended amount of time. Each species is adapting to the slightly different conditions prevalent, and natural selection will allow for them to develop in two different ways until they become recognizably different. Finches on the Galapagos islands are an example of speciation. Speciation by splitting of pre-existing species

29. Phylogeny of the Galapagos Finches Speciation by splitting of pre-existing species

30. The lava lizard is another example of adaptive radiation. On the main islands of the Galapagos the same species can be found, on 6 smaller islands a closely related but different species is found. http:// www.wildherps.com /images/ herps /standard/12050313PD_lava_lizard.jpg Speciation by splitting of pre-existing species

31. Speciation is the formation of a new species by splitting of an existing one. Two processes are required for this: Reproductive isolation Species must stop interbreeding, this causes separation of genes and divergence. A barrier which prevents gene flow between different gene pools achieves this. 2. Differential selection Significant differences in natural selection must occur for traits of two populations to become more and more different. Roles of reproductive isolation in speciation https://www.k-state.edu/biology/p2e/speciation-1.html

32. http:// www.zo.utexas.edu /faculty/ sjasper /images/24.7.jpg Geographic isolation is a form of reproductive (allopatric) isolation in which populations are separated physically by geographic barriers such as rivers, mountains or stretches of water. Harris`antelope ground squirrel White tailed antilope ground squirrel Roles of reproductive isolation in speciation

33. http:// www.bio.utexas.edu /faculty/ sjasper /Bio301M/ popgenetics.html Over time, the populations on either side diverge enough genetically so that at some point they are not able anymore to interbreed. In this case, divergence is facilitated by the absence of gene flow, which would tend to keep populations genetically similar. Roles of reproductive isolation in speciation

34. https://www.researchgate.net/figure/Model-of-population-history-in-Pan-species-with-archaic-gene-flow-into-bonobos-Simplified_fig3_332740806 Roles of reproductive isolation in speciation https://onlinelibrary.wiley.com/doi/10.1002/evan.21456 Bonobos and chimpanzees are both primates from the genus Pan . The range of these two primates does not overlap as they are geographically separated by the Congo River and the two species are not able to swim.

35. Roles of reproductive isolation in speciation https://www.quora.com/Are-bonobos-and-chimpanzees-genetically-different