Basics of cellular aging and

Cellular ageing and theories apoptosis

1. Cellular Ageing and Apoptosis Mallappa Shalavadi Asst. Prof., Dept. of Pharmacology HSK College of Pharmacy, Bagalkot-587101

2. CELLULAR AGING Shakespear - ‘Seven ages of man’ It begins at the moment of conception Involve the differentiation Maturation of the organism and its cells At some variable point in time leads progressive loss of functional capacity characteristic of senescence Ends in death

3. Cellular aging is the result of a progressive decline in the proliferative capacity and life span of cells and the effects of continuous exposure to exogenous factors that cause accumulation of cellular and molecular damage.

4. Normal life span - brain cells live as long as you do and the neurons in CNS once formed by age 6 do not divide. RBC live only 120 days Gender differences - women live longer than men 78 vs 81 years may be due to genetic superiority Different speeds with which mortality increases with age correspond to different maximum life span among species. For example, a mouse is elderly at 2 years, while a human is elderly at 80 years.

5. Intracellular Changes

6. Shortening of Telomeres Accumulation of aging pigments- Lipofuscin accumulation Accumulation of free radicals Weakened immune system Decrease in rate of cell division

7. Extracellular changes The changes occuring in the intercellular spaces and in the lumen of blood vascular system are examples Dementia Dementia is a serious loss of cognitive ability .

8. Alzheimer’s disease

9. Atherosclerosis

10. Parkinson's disease

11. Changes in collagen There is an increase in the amount of collagen proteins deposition in the intercellular spaces. This influences the permeability of cell membranes, affects the speed of diffusion of substances in and out and significantly influences the process of aging.

12. Wrinkles and Ageing Wrinkles are a by-product of the aging process. With age, skin cells divide more slowly, and the inner layer, called the dermis, begins to thin. The network of elastin (the protein which causes skin to stretch) and collagen fibers (the major structural proteins in the skin), which support the outer layer. With aging, skin also loses its elasticity, is less able to retain moisture, oil-secreting glands are less efficient and the skin is slower to heal.

13. Theories of Ageing

14. Mechanisms of cellular aging. Genetic factors and environmental insults combine to produce the cellular abnormalities characteristic of aging

15. The Hallmarks of Aging

16. Genomic Instability One common denominator of aging is the accumulation of genetic damage throughout life P remature aging diseases, such as Werner syndrome.

17. Genomic Alterations

18. Telomere Attrition All normal cells have a limited capacity for replication, and after a fixed number of divisions cells become arrested in a terminally non-dividing state, known as replicative or cellular senescence . How dividing cell count their divisions? Each cell division there is a incomplete replication of chromosome ends [telomere shortening] which ultimately arrest cell cycle. Telomeres are short repeated sequences of DNA [TTAGGG] present at the linear ends of chromosomes that are important for ensuring the complete replication of chromosome ends and for protecting the ends from fusion and degradation.

19. CHROMOSOME TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG AATCCCAATCCC 5’ 3’ TELOMERE

20. Finite population doublings of primary human fibroblasts derived from a newborn, a 100-year-old person, and a 20-year-old patient with Werner's syndrome. The ability of cells to grow to a confluent monolayer decreases with increasing population-doubling levels.

21. The lengths of the telomeres are normally maintained by nucleotide addition mediated by an enzyme called telomerase. Telomerase - specialized RNA-protein complex - uses its own RNA as a template for adding nucleotides to the ends of chromosomes. Telomerase activity is expressed in germ cells and is present at low levels in stem cells, but it is usually absent in most somatic tissues. C ancer cells- telomerase is reactivated and telomeres are not shortened, suggesting that telomere elongation might be an important-possibly essential-step in tumor formation.

22. The role of telomeres and telomerase in replicative senescence of cells

23. Telomerase directs RNA template-dependent DNA synthesis, in which nucleotides are added to one strand at the end of a chromosome. The lagging strand is presumably filled in by DNA polymerase α.

24. Epigenetic Alterations Epigenetic changes involve A lterations in DNA methylation patterns P osttranslational modification of histones Chromatin remodeling In humans and other mammals, DNA methylation levels can be used to accurately estimate the age of tissues and cell types, forming an accurate epigenetic clock . A longitudinal study of twin children showed that, between the ages of 5 and 10, there was divergence of methylation patterns due to environmental rather than genetic influences. There is a global loss of DNA methylation during aging.

25. Histone methylation meets the criteria for a hallmark of aging in invertebrates . Deletion of components of histone methylation complexes extends longevity.

26. Chromatin remodeling  is the rearrangement of chromatin from a condensed state to a transcriptionally accessible state, allowing transcription factors or other DNA binding proteins to access DNA and control gene expression . Global heterochromatin loss and redistribution, which constitute characteristic features of aging Overexpression of this heterochromatin protein extends longevity in flies and delays the muscular deterioration characteristic of old age

27. Loss of Proteostasis Aging and some aging-related diseases are linked to impaired protein homeostasis or proteostasis

28. Deregulated Nutrient Sensing Decreased signaling of IGF-1 receptor- Decreased caloric intake- promotes the ageing.

29. Mitochondrial Dysfunction As cells and organisms age, the efficacy of the respiratory chain tends to diminish, thus increasing electron leakage and reducing ATP generation The relation between mitochondrial dysfunction and aging has been long suspected, but dissecting its details remains as a major challenge for aging research.

30. Role of Free Radicals

31. Stem Cell Exhaustion The decline in the regenerative potential of tissues is one of the most obvious characteristics of aging Hematopoiesis declines with age, resulting in a diminished production of adaptive immune cells and in an increased incidence of anemia and myeloid malignancies Hematopoietic stem cells (HSCs), Mesenchymal stem cells (MSCs), I ntestinal epithelial stem cells (IESCs)

32. Altered Intercellular Communication Beyond cell-autonomous alterations, aging also involves changes at the level of intercellular communication, be it endocrine, neuroendocrine , or neuronal

33. Functional Interconnections between the Hallmarks of Aging

34. Interventions that Might Extend Human Health span

35. https://www.youtube.com/watch?v=MjdpR-TY6QU

36. APOPTOSIS

37. Apoptosis is a pathway of cell death that is induced by a tightly regulated suicide program in which cells destined to die activate enzymes capable of degrading the cells' own nuclear DNA and nuclear and cytoplasmic proteins. Programmed Cell Death Fragments of the apoptotic cells then break off, giving the appearance that is responsible for the name ( apoptosis, "falling off"). Between 50 and 70 billion cells die each day due to apoptosis in the average human adult. For an average child between the ages of 8 and 14, approximately 20 billion to 30 billion cells die a day

38. Causes of Apoptosis

39. Mechanisms of apoptosis

40. The extrinsic (death receptor-initiated) pathway of apoptosis

41. The intrinsic (mitochondrial) pathway of apoptosis

42. The Execution Phase Ececutioner caspase –Caspase-3 and 6 Act on many cellular proteins with cytoskeleton and finally nucleus In nucleus they distrups the proteins involved in transcription, DNA replication and DNA repair. Caspase-3 activates DNase

43. Removal of Dead Cell At early stage of apoptosis, dying cells secretes soluble factors that recruit the Phagocytes. This lead prompt clearance of the apoptotic cells before they undergo secondary necrosis and release their secondary cellular contents which can lead inflammation.