DNA replication

DNA replication is the most important process central dogma in the molecular genetics. So i hope this power point presentation useful to the students of B.Sc Agriculture and M.Sc Genetics and Plant Breeding.

1. Mr. Dev Kumar Arya (Lecturer) Department of Genetics and Plant Breeding O.P. Agriculture College Budhwal, Behror, Alwar (Raj..),India Affiliated to Sri Karan Narendra Agriculture University, Jobner,(Rajasthan),India Gmail: [email protected] DNA REPLICATION

2. Outline Introduction of DNA. What is the DNA replication? Models of DNA replication. - Semi-Conservative DNA replication. -Conservative DNA replication. -Dispersive DNA replication. Direction of DNA replication. Replication of DNA in Prokaryotes. Difference between Eukaryotes and prokaryotes DNA replication. Artificial DNA replication. References

3. Introduction of DNA   In 1865 given by G.J. Mendel characters controled by particulate factors and DNA was discovered in 1868. DNA was discovered in 1869 by a Swiss medical student named  Johann Friedrich Miescher ,(1844-95) obseved the first time this chemical name used Nuclien . The term nucleic acid first time used by Altman in 1889. After 40 years,in 1930 A.Kossel demostrated that nucleic acid on hydrolysis gave four nitrogen-containing compounds(ATGC). In 1920-28.  Frederick Griffith conducted transformation experiments,which on Mouse. Polynucleotide chains were discovered by Levene in 1931. The double-helix model of  DNA  structure was first published in the journal  Nature  by  James Watson  and  Francis Crick  in 1953. The Nobel Prize in Physiology or Medicine 1962 was awarded jointly to Francis Harry Compton Crick, James Dewey Watson and Maurice Hugh Frederick Wilkins. .

4. 20 July 1822 Austrian 6 January 1884 and 13 August 1844-26 August 1895,Switzerland

5. DNA- DNA is genetic material in humans and almost all other organisms(But not some viruses).which gene are composed and capable of storing huge amount Of genetic information,and self replicable .

6. Watson and Crick 1953 Article in nature

7. DNA Replication DNA replication is the biological process of production of new copies of DNA molecule from original DNA molecule. ( DNA DNA) The original DNA strands are used as templates for the synthesis of new strands It occurs very quickly, very accurately and at the appropriate time in the life of the cell DNA to DNA replication is autocatalytic. DNA to RNA replication is hetrocatalytic.

8. STRUCTURAL OVERVIEW OF DNA REPLICATION DNA replication relies on the complementarity of DNA strands The AT/GC rule or Chargaff’s rule The process can be summarized as such The two DNA strands come apart Each serves as a template strand for the synthesis of new strands The two newly-made strands = daughter strands The two original ones = parental strands

9. Chargaff's rules states that DNA from any cell of all organisms should have a 1:1 ratio (base Pair Rule ) of pyrimidine and purine bases and, more specifically, that the amount of guanine is equal to cytosine and the amount of adenine is equal to thymine. Chargaff's rules 11 August 1905 to 20 June 2002

10. Semi-conservative replication of DNA The semi-conservative mode of DNA replication was postulated by Watson and Crick in 1953 along with the double-helix model of DNA. Evidence for semiconservative replication of DNA was first presented by Meselson and Stahl in 1958. They grew E.Coli on 15N (a heavy isotope of 14N) for 14 generations so that the nitrogen present in DNA bases of these cells was 15N DNA having 15N has a dectebably higher density (1.724 g/cm3) than that having 14N (1.710 g/cm3). In 1958 reported the results of an experiment which was degined to test whether double stranded DNA replicates in a semiconservative manner. Model of replication of DNA

11. 24 May 1930 (age 86) and 8 October 1929 (age 87)

12. Conservative DNA replication In this process the two newly synthesized strands obtained by Replication of a DNA molecule would associate to form one double-helix DNA. Both parental strands stay together after DNA replication Dispersive DNA replication In this section the old DNA molecule would break into several piece,each fragment would replicate,and the old and new segement would recombine to yield to progeny DNA molecules.

13. Direction of replication of DNA The presence of replication forks in E.Coli chromosomes was first time shown by J. Cairns in 1963 using the technique of autoradiography. Mostly replication of DNA is unidirectional. Studies with small viruses have convincingly demostrated the bidirectional replication of DNA . One of the simplest and most convincing evidences comes from the E.Coli phageT 7.

14. 21 November 1922 He is a British physician and molecular biologist.

15. Helicase- unwind/open the DNA helix by the breaking hydrogen bonds . Topoisomerase- An enzyme that can induce or relax supercoils of DNA by cut the DNA e.g. change the linking numbers of a DNA molecule. Gyrase-In E.Coli removal of super coiling at DNA replication.this is 2 nd type topoisomerase. Single Strand Binding Proteins - Responsible for holding the replication fork of DNA open while polymerases read the templates and prepare for synthesis. Ligase- An enzyme ,which seals and joining of DNA fragement. DNA Polymerase I- Removal of primer and filling the gap. Primase -This enzyme catalyzes synthesis of the primers,which are small segments of RNA for initiation of DNA replication. DNA dependent RNA polymerase Some enzyme

16. DNA Polymerase III- In charge of synthesizing nucleotides onto the leading end in the classic 5' to 3' direction.which have three Alpha sub units –catalytic (synthesizes DNA) Epsilon subunit-proofreading(remove the mismatched nucleotides) Beta2-clump protein which allows DNA polymerase to slide along the DNA without falling off. Phasphorylase -It is function addition of phosphate. The RNA primer is removed and replaced with DNA polymerase I , and the gap is sealed with DNA ligase . Nuclease- This enzyme is help in proofreading in DNA replication. Telomerase - It is the enzyme responsible for maintenance of the length of telomeres by addition of guanine-rich repetitive sequences.

17. DNA replication in prokaryotes

18. DNA replication in prokaryotes Replication Initiation- The start point of DNA replication is called initation. Enzymes known as helicases unwind the double helix by breaking the hydrogen bonds between complementary base pairs.

19. With the primer as the starting point for the leading strand, a new DNA strand grows one base at a time. The existing strand is a template for the new strand. For example, if the next base on the existing strand is an A, the new strand receives a T. The enzyme DNA polymerase controls elongation, which can occur only in the leading direction. Replication elongation-

20. After elongation is complete, two new double helices have replaced the original helix. During termination, the last primer sequence must be removed from the end of the lagging strand. This last portion of the lagging strand is the telomere section. Termination of DNA replication

21. Several prokaryotes replicons have a specific site called terminus. which stops replication fork. E.Coli chromosome has two termini called ter E,ter D,ter A and ter C,ter B. All ter sequences contain a short (23 bp ) sequence 5’ AATTAGTATGTTGTAACTAAAGT 3’ which functions in only one direction. Termination requires tus gene product which recongnizes the ter sequence bind to it and stops the progress of replication fork. Tus protein provides a contra- helicase activity and stops DNaB from unwinding DNA duplex.

22. DNA replication exhibits a high degree of fidelity Mistakes during the process are extremely rare DNA pol III makes only one mistake per 10 8 bases made There are several reasons why fidelity is high 1. Instability of mismatched pairs Complementary base pairs have much higher stability than mismatched pairs This feature only accounts for part of the fidelity It has an error rate of 1 per 1,000 nucleotides 2. Configuration of the DNA polymerase active site DNA polymerase is unlikely to catalyze bond formation between mismatched pairs This induced-fit phenomenon decreases the error rate to a range of 1 in 100,000 to 1 million Proofreading Mechanisms

23. A schematic drawing of proofreading Site where DNA backbone is cut Polymerase III Epsilon subunit-proofreading(remove the mismatched nucleotides) Nuclease- This enzyme is help in proofreading in DNA replication .

24. 3. Proofreading function of DNA polymerase DNA polymerases can identify a mismatched nucleotide and remove it from the daughter strand The enzyme uses its 3’ to 5’ exonuclease activity to remove the incorrect nucleotide It then changes direction and resumes DNA synthesis in the 5’ to 3’ direction Proofreading Mechanisms

25. Polymerase Polymerization (5 ’ -3 ’ ) Exonuclease (3 ’ -5 ’ ) Exonuclease (5 ’ -3 ’ ) #Copies I Yes Yes Yes 400 II Yes Yes No ? III Yes Yes No 10-20 3 ’ to 5 ’ exonuclease activity Ability to remove nucleotides from the 3 ’ end of the chain Important proofreading ability Without proofreading error rate (mutation rate) is 1 x 10 -6 With proofreading error rate is 1 x 10 -9 (1000-fold decrease) 5 ’ to 3 ’ exonuclease activity functions in DNA replication & repair. In prokaryotes , three main types of DNA polymerase

26. DNA REPLICATION IN EUKARYOTIC Eukaryotic DNA replication is not as well understood as bacterial replication The two processes do have extensive similarities, The bacterial enzymes have also been found in eukaryotes Nevertheless , DNA replication in eukaryotes is more complex Large linear chromosomes Tight packaging within nucleosomes More complicated cell cycle regulation Multiple Origins of Replication Eukaryotes have long linear chromosomes They therefore require multiple origins of replication To ensure that the DNA can be replicated in a reasonable time In 1968, Huberman and Riggs provided evidence for the multiple origins of replication DNA replication proceeds bidirectionally from many origins of replication

27. Replication Bubbles: Pro vs. Euk As the 2 DNA strands open at the origin, Replication Bubbles form Prokaryotes (bacteria) have a single bubble Eukaryotic chromosomes have MANY bubbles Bubbles Bubbles

28. Bidrectional DNA synthesis Replication forks will merge

29. The origins of replication found in eukaryotes have some similarities to those of bacteria Origins of replication in Saccharomyces cerevisiae are termed ARS elements ( A utonomously R eplicating S equence) They are 100-150 bp in length They have a high percentage of A and T They have three or four copies of a specific sequence Similar to the bacterial DnaA boxes Origin recognition complex (ORC) A six-subunit complex that acts as the initiator of eukaryotic DNA replication It appears to be found in all eukaryotes Requires ATP to bind ARS elements Single-stranded DNA stimulates ORC to hydrolyze ATP Multiple Origins of Replication

30. Mammalian cells contain well over a dozen different DNA polymerase Four alpha ( a ), delta ( d ), epsilon ( e ) and gamma ( g ) have the primary function of replicating DNA a , d and e  Nuclear DNA g  Mitochondrial DNA DNA pol a is the only polymerase to associate with primase The DNA pol a / primase complex synthesizes a short RNA-DNA hybrid 10 RNA nucleotides followed by 20 to 30 DNA nucleotides This is used by DNA pol d or e for the processive elongation of the leading and lagging strands Current evidence suggests a greater role for DNA pol d The exchange of DNA pol a for d or e is called a polymerase switch It occurs only after the RNA-DNA hybrid is made Different DNA Polymerases

31. DNA polymerases also play a role in DNA repair DNA pol b is not involved in DNA replication It plays a role in base-excision repair Removal of incorrect bases from damaged DNA Recently, more DNA polymerases have been identified Lesion-replicating polymerases Involved in the replication of damaged DNA They can synthesize a complementary strand over the abnormal region

32. Replication doubles the amount of DNA Therefore the cell must synthesize more histones to accommodate this increase Synthesis of histones occurs during the S phase Histones assemble into octamer structures They associate with the newly made DNA very near the replication fork Thus following DNA replication, each daughter strand has a mixture of “old” and “new” histones Telomeric sequences consist of Moderately repetitive tandem arrays 3’ overhang that is 12-16 nucleotides long Nucleosomes and DNA Replication Telomeric sequences typically consist of Several guanine nucleotides Often many thymine nucleotides

33. DNA polymerases possess two unusual features 1. They synthesize DNA only in the 5’ to 3’ direction 2. They cannot initiate DNA synthesis These two features pose a problem at the 3’ end of linear chromosomes

34. Eukaryotic DNA Replication It occurs inside the nucleus. 2. Origin of replications are numerous. 3 . Initiation is carried out by DNA polymerase α while elongation by DNA polymerase δ and ε. 4. The same are performed by DNA polymerase β. 5. RNA primer is removed by DNA polymerase β. 6. Okazaki fragments are very large 200-300 nucleotides bp long . 7. Replication is slow, some 100 nucleotides per second. 8. DNA gyrase is not needed. 9.In eukaryotes cells have linear DNA which is very complicated. Prokaryotic DNA Replication 1.It occurs inside the cytoplasm. 2.There is single origin of replication. 3. DNA polymerase III carries out both initiation and elongation. 4. DNA repair and gap filling are done by DNA polymerase I. 5. RNA primer is removed by DNA polymerase I. 6. Okazaki fragments are very short 25-30 nucleotides bp long. 7. Replication is very rapid, some 2000 bp per second. 8. DNA gyrase is needed. 9.In prokaryotes cells have circular DNA. Differences between Prokaryotic and Eukaryotic DNA Replication

35. Polymerase chain reaction PCR uses a pair of primers to span a target region in template DNA, and then polymerizes partner strands in each direction from these primers using a thermostable DNA polymerase. This technique given by kary mulies in 1985 . Repeating this process through multiple cycles amplifies the targeted DNA region. This technique is based on temperature. Artificial replication of DNA December 28, 1944 (age 72)

36. Reference Singh B.D.2009,Genetics, Kalyani Publications, Ludhiana, Punjab, India. Gupta P.K.2015,Genetics,Rastogi Publication, Meerut, Uttar Pradesh, India. Prasad B.K. 2006,Fundamental Genetics,Kalyani Publications, Ludhiana, Punjab, India. Singh Phundan.2005,Genetics,Kalyani Publications, Ludhiana, Punjab, India. Sir-Kumar Sachin,2017,Powerpoint Presentation, CCS University, Meerut, Uttar Pradesh, India. By Google.

37. Thank You for listening Any question for me