GENETIC ENGINEERING for STEM SHS Students.ppt

This slideshow presents genetic engineering to SHS STEM Track students.

1. Genetic Engineering

2. •Genetic engineering: Changing the DNA in
living organisms to create something new.

•This organisms are called Genetically
Modified Organism (GMO)
•Example:
•Bacteria that produce human insulin
•Genetically Modified organism are called
transgenic organism; since genes are
transferred from one organism to another.

3. Some genetic engineering techniques are
as follows:
1. Artificial selection
A. selective breeding
B. hybridization
C. inbreeding
2. Cloning
3. Gene splicing
4. Gel electrophoresis: analyzing DNA

4. 1. artificial selection: breeders choose which
organism to mate to produce offspring with
desired traits.
•They cannot control what genes are passed.
•When they get offspring with the desired traits,
the maintain them.
Three types of artificial selection:
A. selective breeding
B. hybridization
C. inbreeding

5. A. Selective breedingA. Selective breeding:: when animals with when animals with
desired characteristics are mated to produce desired characteristics are mated to produce
offspring with those desired traits.offspring with those desired traits.
•Passing of important genes to next Passing of important genes to next
generation.generation.
•Example: Champion race horses, cows with Example: Champion race horses, cows with
tender meat, large juicy oranges on a tree.tender meat, large juicy oranges on a tree.

6. •For example people breed dogs for specific
purposes.
•Dachshund were once bred to hunt badgers
and other burrowing animals.
•They must be small to fit into the animals hole
in the ground.

7. •Selective breeding occurs when you choose the
best male and female to breed.
•This allows you to fine tune and control the
traits
•The offspring or babies will then have the best
traits.
•Then you continue to breed those organism
with the best traits, those traits will be
maintained.

8. •Examples of
selective breeding:
•Angus cows are bred to
increase muscle mass so
that we get more meat,
•Egg-Laying Hen-
produces more eggs
than the average hen

9. •B. HybridizationsB. Hybridizations: two individuals with unlike : two individuals with unlike
characteristics are crossed to produce the best in both characteristics are crossed to produce the best in both
organisms. organisms.
•Example: Luther Burbank created a disease resistant Example: Luther Burbank created a disease resistant
potato called the Burbank potato. potato called the Burbank potato.
•He crossed a disease resistant plant with one that had He crossed a disease resistant plant with one that had
a large food producing capacity. a large food producing capacity.
•Result: disease resistant plant that makes a lot of Result: disease resistant plant that makes a lot of
potatoes. potatoes.

10. Other Examples of hybridization:
1.Liger: lion and tiger mix

11. 2. Grape + apple= grapple. The fruit
tastes like grapes and looks like apple.

12. C. Inbreeding breeding of organism that breeding of organism that
genetically similar to maintain desired traits.genetically similar to maintain desired traits.
•Dogs breeds are kept pure this way.Dogs breeds are kept pure this way.
•Its how a Doberman remains a Doberman. Its how a Doberman remains a Doberman.
•It keeps each breed unique from others.It keeps each breed unique from others.
•Risk: since both have the same genes, the Risk: since both have the same genes, the
chance that a baby will get a recessive chance that a baby will get a recessive
genetic disorder is high. genetic disorder is high.
•Risks: blindness, joint deformities. Risks: blindness, joint deformities.

13. •Variation:Variation: difference between difference between
individuals of a species.individuals of a species.
•The differences are in the The differences are in the
genes but we see the physical genes but we see the physical
differences. differences.
•For example: Some humans For example: Some humans
have blond hair and some have blond hair and some
have brown. This is a variation have brown. This is a variation
among humans.among humans.
•Some finches have short Some finches have short
beaks, some have long beaks.beaks, some have long beaks.
•Inbreeding decreases Inbreeding decreases
variations.variations.

14. 2. Cloning2. Cloning: creating an organism that is an : creating an organism that is an
exact genetic copy of another. exact genetic copy of another.
•There are human clones in our school. There are human clones in our school.
•identical twins are naturally created clones. identical twins are naturally created clones.
•Clone:Clone: group of cells or organisms that are group of cells or organisms that are
genetically identical as a result of genetically identical as a result of asexual asexual
reproductionreproduction
•They will have the same exact DNA as the They will have the same exact DNA as the
parent.parent.

15. How is cloning done?How is cloning done?
►A single cell is removed from a parent A single cell is removed from a parent
organism. organism.
►An entire individual is grown from that cell. An entire individual is grown from that cell.
►Remember one cell has all the DNA needed Remember one cell has all the DNA needed
to make an entire organism. to make an entire organism.
►Each cell in the body has the same DNA, but Each cell in the body has the same DNA, but
cells vary because different genes are turned cells vary because different genes are turned
on in each cell. on in each cell.

16. Dolly:Dolly:
•Dolly was the first Dolly was the first
mammal cloned.mammal cloned.
•She had the same exact She had the same exact
DNA as her mother and DNA as her mother and
had no father.had no father.
•Cloning is a form of Cloning is a form of
asexual reproduction.asexual reproduction.
•Only one genetic parent.Only one genetic parent.
http://content.tutorvista.com/biology_11/content/media/cloning.swf

17. •Since Dolly, cats and other organisms have Since Dolly, cats and other organisms have
been cloned. been cloned.
•The cat that was cloned had the same The cat that was cloned had the same
exact DNA but different color fur than the exact DNA but different color fur than the
mother. mother.
•How can this be?How can this be?
•Environment plays a huge part in the way Environment plays a huge part in the way
organisms develop.organisms develop.

18. •Eggs are haploid
•Haploid: half the
chromosomes, 23 in
humans
•Body cells are diploid:
•Diploid: two sets of
chromosomes, one from
mom and one set from
dad 46 in humans.

19. How could you clone
a human?
•Step 1: An egg is
removed from a female
human
•Eggs are haploid: 23
chromosomes.
•The nucleus of the egg
is removed and is
thrown away.
23
EGG CELL

20. •Step 2: A body cell is
removed from another
person.
•The nucleus of the
body cell is removed
•Body cells are diploid:
46 chromosomes.
46
Body Cell

21. •Step 3:
•The nucleus of the
diploid body cell is put
into the egg.
•This egg no longer
needs to be fertilized
since it has all 46
chromosomes.
46
EGG CELL

22. •Step 4: The egg is then
charged with electricity to
start mitosis.
•Step 5: It is then put into a
surrogate mother so it can
grow.
•Its going to be genetically
identical to the parent of the
body cell.
•But it will be a baby.
•Plants and animals can be
cloned.

24. Click and cloneClick and clone
•http://learn.genetics.utah.edu/content/tech/cloni
ng/clickandclone/

25. Benefits of cloning:
1.you can make exact
copies of organisms
with strong traits.
2.Increase food supply
3.Medical purposes:
clone organs for
transplants.
4.Bring back or Stop
species from going
extinct.
Saber Tooth Tiger extinct

26. Risks of cloning:
1.Decreases genetic
diversity
2.If one of your clones
gets a disease, they all
get it: same immune
system.
3.Inefficient: high failure
rate: 90%+
4.Expensive

27. 3. Gene splicing: DNA is cut
out of one organism and put
into another organism
•A trait will be transferred from
one organism to another.
•For example: the human
insulin gene can be removed
from a human cell.
•It can be put into a bacterial
cell.
•The bacterial will now make
human insulin.

28. •This picture represents gene splicing.
•However, DNA is much smaller.
•Its done with high tech lab equipment since
DNA, is too small to hold or see without a
microscope.
The red piece the woman
is holding is an insulin
gene from a human
being. It is being
combined with DNA from
a bacteria.
Creates recombinant
DNA, something that has
never existed before.

29. Benefits:
•insulin is cheaper
•There are no side
effects because it
is human insulin.
•We once used pig
insulin but there
are side effects
and it more
expensive.

30. How are genes cut for gene splicing?How are genes cut for gene splicing?
•A bacterial A bacterial plasmidplasmid is used. is used.
•Plasmid:Plasmid: circular DNA in a bacteria circular DNA in a bacteria
cell. cell.
•It is very simple and easy to It is very simple and easy to
manipulate. manipulate.

31. •A A restriction enzyme:restriction enzyme: enzyme that cuts the enzyme that cuts the
DNA at a specific code. DNA at a specific code.
•There are thousands of restriction enzymes.There are thousands of restriction enzymes.
•Each cuts DNA at a different sequence.Each cuts DNA at a different sequence.
•Some look for GGCC and cut in between the G Some look for GGCC and cut in between the G
and C. and C.
•Every time GGCC is found in the DNA it is cut Every time GGCC is found in the DNA it is cut
by the restriction enzymeby the restriction enzyme
DNA Code:DNA Code:
•TTATGGCCATACGGCCTTTTATGGCCATACGGCCTT
•AATACCGGTATGCCGGAAAATACCGGTATGCCGGAA

32. •TTATGGCCATACGGCCTTTTATGGCCATACGGCCTT
•AATACCGGTATGCCGGAAAATACCGGTATGCCGGAA
•TTATGG CCATACGG CCTTTTATGG CCATACGG CCTT
•AATACC GGTATGCC GGAAAATACC GGTATGCC GGAA
•This DNA segment was cut twice creating three This DNA segment was cut twice creating three
fragments. fragments.
•Since every one is different, we all have a Since every one is different, we all have a
different amount of times GGCC is found. different amount of times GGCC is found.
•My DNA may be cut seven timesMy DNA may be cut seven times
•Yours may be cut ten times. Yours may be cut ten times.

33. This is how a restriction enzyme
works

34. How is gene
splicing done?
1. A restriction
enzyme cuts the
insulin gene out of
the human DNA.
2. A plasmid is
removed from a
bacteria and cut
with a restriction
enzyme

35. 3. The human gene is place into the bacteria
plasmid
4. The plasmid is placed back into the bacteria.
•The cell now has directions (DNA) to make
insulin.
•That's exactly what it does.
•Its human insulin, bacteria do not make insulin
on their own.
Plasmid with
insulin gene

36. •This is called This is called transformation: transformation: when a gene when a gene
from one organism is transferred to different from one organism is transferred to different
organism.organism.
•The organisms that have DNA transferred to The organisms that have DNA transferred to
them are called them are called transgenic organismstransgenic organisms..
•transtrans: means different, : means different,
•genicgenic: refers to genes: refers to genes
•Genetic engineering has given rise to a new Genetic engineering has given rise to a new
technological field called technological field called biotechnologybiotechnology
(technology of life).(technology of life).

37. 1. Transgenic (1. Transgenic (GMO)GMO) animals animals: genes : genes
inserted into animals so they produce what inserted into animals so they produce what
humans need. humans need.
• Why?: A way to improve the food supply: Why?: A way to improve the food supply:
A. A. Transgenic cowsTransgenic cows: gene inserted to : gene inserted to
increase milk production. increase milk production.

38. B. Spider goatB. Spider goat: gene from spider inserted : gene from spider inserted
into goat. into goat.
•Goats makes silk of the spider web in their Goats makes silk of the spider web in their
milk. milk.
•Flexible, stronger than steel. Used in Flexible, stronger than steel. Used in
bullet proof jackets.bullet proof jackets.

39. C. Glow-in-the-dark
cats
 
•Scientist used a
virus to insert DNA
from jellyfish
•The gene made the
cat produce a
fluorescent protein
in its fur.
 

40. 2. Transgenic bacteria:2. Transgenic bacteria: gene inserted gene inserted
into bacteria so they produce things into bacteria so they produce things
humans need. humans need.
•For example: insulin and clotting factors For example: insulin and clotting factors
in blood are now made by bacteria.in blood are now made by bacteria.

41. 3. Transgenic plants:3. Transgenic plants: plants are given plants are given
genes so they meet human needs. genes so they meet human needs.
A. Transgenic corn:A. Transgenic corn: given a gene so corn given a gene so corn
produces a natural pesticide. produces a natural pesticide.
Now they don’t have to be sprayed with Now they don’t have to be sprayed with
cancer causing pesticides. cancer causing pesticides.
•25% of all corn is like this. 25% of all corn is like this.

42. B. Venomous cabbage
•gene from a scorpion tails
inserted into cabbage.
•Cabbage now produces
that chemical.
•Why? Limit pesticide use
while still preventing
insects from damaging
crops.
•Corporations state the
toxin is modified so it isn’t
harmful to humans.

43. C. Banana vaccines
•virus is injected into a banana,
the virus DNA becomes part of
the plant.
•As the plant grows, it produces
the virus proteins — but not the
disease part of the virus.
•When people eat a bite, their
immune systems creates
antibodies to fight the disease
— just like a traditional vaccine
•Vaccines for hepatitis and
cholera

44. •A virus is often used to deliver DNA.
•In the movie “I Am Legend,” A healthy gene was
inserted into a virus.
•The virus invaded the cancer cells and inserts the
healthy gene to cure cancer.
•Worked at first but the virus mutated and became
deadly.
•This is being attempted in real life.

45. •Gene therapy: when disease causing
genes are cut out and good gene are
inserted.
•Restriction enzymes are used to cut out
bad genes.
•Viruses are used to insert good genes.
•Not approved for human use yet.
•Some possible side effects.

46. 4. Gel electrophoresis: a
technique used to compare
DNA from two or more
organisms.
Why compare DNA:
1.Find your baby’s daddy
2.Who committed a crime.
3.How closely species are
related.

47. How is
electrophoresis
done?
A. The DNA is cut into
fragments with a
restriction enzyme.
B. The cut DNA is then
put into the wells of a
machine filled with
gel.
•The gel is spongy and
the DNA squeezes
through the pores.

48. C. The machine is plugged in and the
fragments get separated based on their size.
•The smaller fragments move further than the
large.

49. •Electrophoresis
results
Separation of DNA based on
size of fragments.
Final result of electrophoresis

50. •Electricity provides the energy
•Why does DNA move?
• DNA has a negative charge.
•When the machine is plugged it, its moves towards
the positive pole created by the electricity

51. electrophoresiselectrophoresis

52. Your DNA is so unique its considered to be a
DNA fingerprint.
Gel electrophoresis will separate your DNA
differently from anyone else.
Nova: who done itNova: who done it
http://www.pbs.org/wgbh/nova/sheppard/analyze.html
http://www.teachersdomain.org/asset/tdc02_i
nt_creatednafp2/

53. •Genetic engineering creates organisms with
recombinant DNA.
•Recombinant DNA: when DNA is
combined from at least two organisms.
Which techniques create recombinant DNA
1.Sexual reproduction: natural
2.selective breeding
3.Hybridization
4.Gene splicing

54. •Does cloning create organisms with
recombinant DNA?
•No, the DNA from one organism is
copied.
•DNA is not recombined.