Homologous Recombination (HR)

Homologous Recombination (HR)
Dated:05-12-2014

1. Homologous Recombination (HR) RAGHAVENDRA N.R PhD Scholar Plant Breeding & Genetics Punjab Agricultural University Ludhiana-141004

2. Seminar Outline Introduction M echanism of Homologous Recombination Molecular basis of Homologous Recombination Biological roles of Homologous Recombination Practical applications Conclusion

3. Background Knowledge 1866 : Gregor Mendel – Principles of Inheritance 1900 : Bateson and Punnett –some genes can be inherited together 1913 : Morgan & Sturtevant –crossover can occur between linked genes 1931 McClintock and Creighton –crossover happens both in meiosis and mitosis 1947 : Lederberg found recombination in bacteria 1964 : Robin Holliday –Holliday Junction 1983 : Jack Szostak –DSBR pathway

4. Recombination can occur between similar molecules of DNA, as in homologous recombination, or dissimilar molecules, as in non-homologous end joining (NHEJ) or IR. Specialized recombination called Site-specific recombination, first characterized in prokaryotes SSR is responsible for integration of phage genomes into the bacterial chromosomes. Transposition allows one DNA sequence to be inserted into another without relying on sequence homology. Types of Recombination

5. Cont..

6. CACATGATACGTCCGATCACATTTGTTGTTCATAT GTGTACTATGCAGGCTAGTGTAAA C Synapsis C CACATGATACGTCCGATCACATTTGTTGTTCATAT GTGTACTATGCAGGCTAGTGTAAA A A GTATA A A GTATA CACATGATACGTCCGATCACATTTGTTGTTCATAT GTGTACTATGCAGGCTAGTGTAAACAACAAGTATA GTGTACTATGCAGGCTAGTGTAAACAACAAGTATA CACATGATACGTCCGATCACATTTGTTGTTCATAT - Sequences must be the same or very similar

7. What is Homologous Recombination..? Adapted from B. Alberts, et al., Molecular Biology of the Cell, Fourth edition. Garland Science, 2002.

8. DNA Breaks & It’s Consequences Internal and external, biotic and abiotic sources

9. Genome Stability & Environment Waterworth et al (2011)

10. DNA damage response and chromatin remodelling activity in plants Roy S (2014)

11. Initiation o f HR at the Molecular Level Bernard de Massy Annu. Rev. Genet. 2013. 47:563–99 Spo11 : The Catalytic Activity for Double-Strand Break Formation DSB formation requires additional proteins whose activities are not yet characterized.

12. Recombinase as RecA / Rad51/ Dmc1 bind to the ss -DNA Accessory factors as Rad54, Rad54B, and Rdh54 help recognize and invade the homologous region Cont.. Bernard de Massy Annu. Rev. Genet. 2013. 47:563–99

13. After the formation of D-loop, DNA polymerase involved to elongate the 3’ invading single strand Cont.. Bernard de Massy Annu. Rev. Genet. 2013. 47:563–99

14. Key steps of HR Alignment of two homologous DNA molecules Introduction of breaks in the DNA Formation of initial short regions of base pairing between the two recombining DNA molecules. Strand invasion . Formation of Holliday junction & Cleavage of the Holliday junction

15. Two Models For Homologous Recombination 1.The Holliday Model 2.The Double-Strand Break Repair Model (More accurately describes recombination processes)

16. The Holliday Model Homologous duplex Single strand breaks

17. Cont.. Strand invasion Branch migration

18. Cont.. Holiday Junction

19. Holiday Junction cleavage Cont.. Resolution p atch recombinant splice recombinant

20. The Double-Strand Break Repair Model

21. Cont..

22. Prokaryotic Recombination

23. Nature 374, 375 (1995) A simple model of a RuvA / RuvB /DNA complex_ electron microscopy

24. Programmed generation of double-stranded DNA breaks occurs during meiosis Mechanism of cleavage by Spo11 Homologous Recombination in Eukaryotes DNA dynamics during meiosis

25. Homologous Recombination in Eukaryotes Recombination Resolution

26. PROKARYOTIC AND EUKARYOTIC PROTEINS CATALYST REQUIRED FOR HR Adopted from: Molecular Biology of the Gene , (2013) 7 th Ed, Benjamin Cummings, London . Pairing homologous DNAs and strand invasion E. coli Protein Catalyst Eukaryotic Protein Catalyst Recombination Step RecA protein Rad51 Dcm1 (in meiosis) Introduction of DSB None Spo11 (in meiosis) HO ( for mating-type switching) Processing DNA breaks to generate single strands for invasion RecBCD helicase/nuclease MRX protein (also called Rad50/58/ 60 nuclease) Assembly of strand-exchange proteins RecBCD and RecA Rad52 and Rad59 Holliday junction recognition and branch migration RuvAB complex Not well characterized Resolution of Holliday junctions RuvC Rad51c–XRCC3 complex, WRN, and BL

27. Recombination repair DNA breaks Homologous recombination Resection Rad50, Mre11, Xrs2 complex Strand invasion Rad52 Rad51; BRCA2 DNA synthesis     Ligation, branch migration, Holliday junction resolution DSB Non-homologous end-joining Ku70, Ku80 Ligation DSB DNA-PKcs Rad50, Mre11, Xrs2 complex “Cleaning up” of ends XRCC4/Ligase IV

28. Gene knockouts/Point mutations & Generating new gene/allele combinations fueling incredible Genetic diversity. Ensures proper segregation of homologous chromosome pairs ( Meo -I) Preservation of Replication forks, restart replication (Escort) telomere maintenance. Ensures genomic stability of the organism. Repairs damaged DNA rendered due to External & Internal factors. Gene Conversion Accounts for Interallelic Recombination Genetic disorders. Biological roles of Homologous Recombination

29. INHERITED HUMAN DISEASES CAUSED BY DEFECT IN DNA REPAIR BREAST CANCER (BRCA1) BERLIN BREAK SYNDROME (BLM) ATAXIA (ATM) XERODERMA PIGMENTATION (XPA) FANCONI ANAEMIA (FA) BLM FA AT XP This was the most unkindest cut of all… Then, I and you and all of us fell down, Whilst bloody flourished over us

30. Practical Applications Used to map genes on chromosomes Making transgenic cells and organisms. Homology-dependent gene silencing/ Reverse breeding /Alien Introgression / Heterosis. Exploring gene sequence and its function. ( Functional Genomics ) Gene Targeting in mammals & plants. Engineering by HR: Recombineering! [ CRISPRs / C as , ZFN, TALENs ]

31. An endogenous gene can be replaced by a transfected gene using homologous recombination. Or Any Gene Modification via.. HR. Gene Targeting

32. GENERAL STRATEGY FOR GENE TARGETING IN MICE

33. Cont..

34. Gene T argeting A Novel Model System for Plant Development and Genomic Studies Physcomitrella patens Schaefer   (1997) Efficient gene targeting in the moss   Physcomitrella patens Kempinet et al (1997) Targeted disruption in  Arabidopsis .

35. Targeted genome engineering has emerged as an alternative to classical plant breeding and transgenic (GMO) methods to improve crop plants and ensure sustainable food production. The ability to precisely alter the DNA information in living cells at loci/sites of our own choice Genome Editing!!!

36. The ability to introduce targeted, tailored changes into the genomes of several species will make it feasible to ask more precise biological questions.

37. Conclusion

38. Hunger kills more than Ebola, but it’s not considered a significant problem Since, rich people can’t die of it.

39. Say No To Food Waste