Role of insect resistance in plants

Insect resistance

1. ROLE OF INSECT RESISTANCE IN PLANTS

2. INTRODUCTION Like disease, insects are important causal factors of biotic stress in crop plants. Insects attack all the crop plants and lead to considerable losses in yield as well as quality.

3. Insects cause yield loss in both direct and indirect losses. Insects cause direct losses by , Sucking cell sap – Sucking insects. Eating plant parts – Tissue feeding insects. Insects cause indirect damage by , Acting as vectors for transmission of diseases.

4. Both insects and diseases are the biotic factors which cause Insects attack the plants and leads to damages like Reduction in plant growth and stunting. Damage of vegetative & reproductive parts. Premature defoliation. Wilting of plants.

5. Why insect resistance ? 14% annual losses of potential crop yields is due to insect pests. Increasing the cost – benefit ratio. Reducing the environmental pollution. Resistant varieties non toxic to man , farm animals & wild life.

6. Important methods of insect control Bio logical method Use of botanical pesticides Use of resistant varieties Chemical methods Use of predators & parasites of insect pests

7. Mechanisms of Insect Resistance There are four mechanisms of insect resistance. 1) Non preference 2) Antibiosis 3) Tolerance and 4) Avoidance or Escape . The first three mechanisms were given by Painter (1951) and the fourth one was added subsequently.

8. Non preference for oviposition ,food or shelter Antibiosis adverse effect of plant on Biology of insect Tolerence repair , recovery or ability to withstand infestation

9. Non preference : Non acceptance / anti- xenosis . The host varieties that are unattractive or unsuitable for colonization, oviposition or both by the insects. The characters adopted by the plants include hairyness,different colours, leaf angle etc

10.   Non Preference Mechanism of Insect Resistance in Some Crop Plants:

11. 2. Antibiosis Antibiosis refers to the adverse effect of host plant on the development and reproduction of insect pests which feed on resistant plant. In some cases, antibiosis may lead even to death of an insect. An antibiosis is considered as the true form of resistance to insect pests.

12. Antibiosis Mechanism of Insect Resistance in Some Crop Plants

13. 3. Tolerance Tolerance refers to the ability of a variety to produce greater yield than susceptible variety at the same level of insect attack. The tolerance is measured in terms of rejuvenation potential, healthy leaf growth, flowering and superior plant vigour . Hybrid cottons, by virtue of their very high potential , show tolerance to insect pest.    

14. 4.Avoidance It refers to escape of variety from insect attack either due to earliness or due to its cultivation in season where insect population is low E.g. Early maturing cotton varieties - Pink boll worm

15. Basis of Insect Resistance in Plant Breeding There are three important basis of insect resistance, 1) morphological 2) Physiological 3) Biochemical features of host plant.

16. A. Morphological factors: Hairiness – E.g. jassids in cotton Colour of plant – E.g. red cabbage not favored by butterflies Solid stem toughness of the tissues – E.g. resistance to saw fly in wheat High tillers – rice against stem borer Long pedicels - cotton against bollworms

17. B. Physiological Factors: Some physiological factors such as osmotic concentration of cell sap and leaf exudates are associated with insect resistance. Some species of solanum gummy exudates from hairs on the leaves. Aphids and Colorado beetles get trapped in such exudates and are unable to feed and reproduce. Osmotic concentration of sap & exudates – cotton resist to jassids

18. C. Biochemical factors More important than physiological and morphological factors. In rice – high silica content in shoot confers resistance to stem borer In wheat and barley – benzyl alcohol resist to green bugs. In cotton resistance to insects is by gossypol, a phenolic compound.

19. Genetics of insect resistance Resistance to insects is governed in 3 ways Oligogenes – in wheat to hessian fly & saw fly, in barley to green bugs, in alfalfa to pea aphid, in cotton to jassids etc Polygenes- in cereals to leaf bettle, in rice to stem borer etc Cytoplasmic genes – in maize to European corn borer & to root aphid in lettuce

20. Polygenic Resistance : Several genes Wheat- cereal leaf beetle Alfalfa- Spotted aphid

21. Cytoplasmic Resistance : Plasma genes Maize - European corn borer

22. Source of Insect Resistance in Plant Breeding There are five different source of insect resistance in crop plants 1) Cultivated varieties 2) Germplasm collections 3) Wild species 4) Mutations and 5) Microorganism.

23. Cultivated variety: Khand waz , B 1007 of G.hirsutum – Jassids Germplasm collections: In cotton several strains resistant to jassids . Related wild species: Resistance for Rubus aphid in its wild species of Raspberries. G.tomentosum , G.anomalum & G.armourianum are good sources of jassid resistance in cotton. In tobacco , resistance to root knot nematode from its wild species.

24. Induced Mutation: Sometimes, insect resistance is obtained through induced mutations. Insect resistance has been obtained in many crops by this method. Micro Organisms: Now microorganisms are being used as source of resistance to insect pests. . In USA, Monsanto Company has transferred a gene from Bacillus thuringiensis (Bt) into the system of cotton plant through genetic engineering.

25. Durable Resistance in Plant Breeding It refers to long lasting resistance . The durability of resistance depends mainly on four factors Formation of new races/ biotype Genetics of resistance Morphological features of host plant and Biochemical substances associated with resistance .

26. 1. New Biotypes: New physiological races are formed through spontaneous mutations and hybridization. 2. Genetics of Resistance: In general, monogenic resistance is lesser durable than oligogenic and polygenic resistances. 3. Morphological Characters: Insect resistance associated with morphological and anatomical features of host plant is more durable than other kinds of resistance.

27. 4. Biochemical Factors: In some cases, durable resistance is associated with biochemical substances present in the host plant. For example, durable resistance to European corn borer in maize is associated with high DIMBOA content ,to stem borer in rice with high silica content and to spotted and pea aphid in alfalfa with high saponin content.

28. BREEDING METHODS FOR INSECT RESISTANCE The methods of breeding for disease resistance are same as those used for other agronomic traits. They are : 1. Introduction 2. Selection 3. Hybridization 4. Genetic Engineering

29. Breeding methods for insect resistance Introduction: Phylloxera resistance grape root stock from U.S.A into France. Selection: Resistance to alfalfa spotted aphid Hybridization : Pedigree – oligogenic characters Back cross – polygenic character Genetic Engineering : Cry gene resistance in cotton.

30. Screening techniques Field screening : Interplanting In highly prone areas In a particular season Transferring of eggs or larvae manually to each test plant. Glass house screening : More reliable than field screening.

31. Problems in breeding for insect resistance It is a long term process. Sometimes , breeding for resistance to one pest leads to the susceptibility to another pest. E.g. Glabrous strains of cotton resistant to bollworms but susceptible to jassids. Hairiness in cotton resistant to jassids but susceptible to whiteflies & bollworms.

32. Linkage between desirable & undesirable genes. It is the expensive & difficult method. In some cases resistant variety has lower yield and poor quality.

33. Achievements in different crops

34. RICE Vijaya – Leaf hopper Ratna , Cauveri– Stemborer Vajram , Chaitanya , Pratibha – BPH Surekha , Kakatiya – Gall midge SORGHUM SPV – 86 , IS – 1054 –Shootfly SPV – 17 ,19 , 29 – Stem borer ICSV – 197 , 745 - Midge

35. COTTON B 1007 , Khandra – 2 – Jassids MCU 7 , LH 900 – Boll worms Kanchana , Supriya – Whitefly GM Crops : Bt cotton- Bollworms Bt corn – European corn borer

36. GM CROPS Pest resistant GM crops (primarily cotton and maize), have been genetically modified so they are toxic to certain insects . They are often called Bt crops because the introduced genes were originally identified in a bacterial species called Bacillus thuringiensis .

37. Bacillus thuringiensis is commonly known as a gram-positive bacterium that occurs naturally in the soil around the world. For decades, bacteriologists have known that some strains of Bt kill certain insects and that the toxic substance responsible for the Insects death is a protein. When certain insects ingest either the bacterium or the protein produced by the bacterium (the protein is called Δ - endo toxin), the function of their digestive systems is disrupted, eventually resulting in death.

38. Bt is not effective against all insects; however different Bt strains are effective against specific species. The major families of insects that respond to Bt are: Lepidoptera (caterpillars; e.g. European corn borer or cotton boll worm). Coleoptera (beetles; e.g. Colorado potato beetles) Diptera (flies and mosquitoes)

39. Case Study on the Development of Bt Transgenic Cotton It describes how Monsanto developed its first transgenic Bt cotton ( Gossypium hirsutum ) marketed since 1996 in the USA under the trade name Bollgard . In cotton, bollworms cause significant yield losses Three types of bollworms, viz. American bollworm ( Helicoverpa armigera ), pink bollworm ( Pectinophora gossypiella ) and spotted bollworms ( Earias vitella ) attack cotton crop.

40. Bt Endotoxins and their Genes Initially, Bt toxins were classified into 14 distinct groups and 4 classes (based on their host range). These are: Cry I (active against Lepidoptera [“Cry” stands for “crystalline” reflecting the crystalline appearance of the δ- endotoxin ; “Cry” is used to denote the protein whereas “cry” denotes the respective gene]). Cry II (Lepidoptera and Diptera), Cry III (Coleoptera) Cry IV (Diptera).

41. PROCEDURE

42. The major players in transgenic Bt plant technology therefore are Monsanto, Novartis, AgrEvo and Mycogen with their own technologies. The first two field trials with Bt transgenic cotton were conducted in the USA by Monsanto and by Agrigenetics and the first results of these trials were published by Deaton (1991). Standard biosafety regulatory clearance by the Animal Plant Health Inspection Service (APHIS) of the United States Department of Agriculture (USDA) was issued for these trials. The biosafety review ensured the safety of the expressed protein, cotton seed and fiber (potential avenues of exposure to humans, animals and non-target organisms), and stipulated certain required environmental precautions.

43. The studies showed that the Bt protein is produced throughout the plant at levels ranging from 5.4 to 28.3 micrograms per gram of fresh weight (or µg/g) with lower amounts in the roots. Monsanto claims to have studied on all aspects like high dose expression, agronomic practices, monitoring insect resistance, and pyramiding traits. They commercialized in 1996

44. Bt Cotton and Adoption in India The development of Bt cotton in India from the transgenic cotton of Monsanto, USA, underwent a stringent regulatory process before it finally reached farmer fields. Mahyco had obtained Coker 312-Bt (Cry1Ac)-cotton seed from Monsanto USA, in 1996. Bt cotton was first adopted in India as hybrid in 2002. In India, after extensive testing of Bt cotton hybrids (with Cry1 Ac gene) in All India Coordinated Cotton Improvement Project (AICCIP) and farmers field, Government of India has approved commercial cultivation of Bt cotton hybrid with effect from 2002 crop season.

45. Within a span of five years nearly 41% of the cotton area in India came under Bt hybrid umbrella. Large scale cultivation of Bt cotton has resulted in the significant reduction of insecticide use to the tune of 40 to 60% less than the intensity on the corresponding non-transgenic varieties. The country was the third largest importer of cotton in the world in 2002-03. In 2005-06 the country was the third largest exporter of cotton in the world. RESULTS

46. REASONS FOR SUCCESS Insecticide application costs-NIL • Labour costs Effective control of target pests • Human and animal health benefits through reduced hazards • Environmental benefits and • Indirect benefits through higher levels of beneficial predators.

47. Development of insect resistant maize plants expressing a chitinase gene from the cotton leaf worm ,Spodoptera littoralis . - Europe PMC,In DECEMBER 2015,By Gamal H. Osman , Shireen K. Assem , Rasha M. Alreedy , Doaa K. El- Ghareeb , Mahmoud A. Basry , Anshu Rastogi and Hazem M. Kalaji

48. ABSTRACT: Corn is considered the most important cereal crop after wheat and rice all over the world. Corn borers ( S.cretica , Ostrinia nubilalis ) are serious insect pests and responsible for significant loss of crop yield. Due to the importance of chitinolyutic enzymes and the ability of chitinases to attack and digest chitin in the peritrophic matrix or exoskeleton raises the possibility to use them as insect control method. In this study, an insect chitinase cDNA from cotton leaf worm has been synthesized. Insect chitinase transcripts and proteins were expressed in transgenic maize plants. The bioassays using transgenic corn plants against corn borer ( Sesamia cretica ) revealed that ~50% of the insects reared on such plants died, suggesting that transgenic maize plants have enhanced resistance against S. cretica . It is possible that the chitinase gene transfer technology will become as effective as the Bt gene transfer for the production of a pesticide free environment. In fact, chitinase gene transfer technology may ultimately prove to be more important, since chitinase affects the growth and survival of both insect and fungal pathogens.

49. Materials and Methods: Insect samples of S. littoralis and S.cretica were obtained from the insectary at the Agricultural Genetic Engineering Research Institute (AGERI), ARC-Egypt. Synthesis and cloning of cDNA encoding an insect chitinase gene: Total RNA was isolated from the integuments of third instar larvae of S. littoralis using the QIAGEN kit for total RNA isolation. First strand cDNA was synthesized from the total RNA isolated using cDNA reverse transcriptase. The total cDNA obtained was then used as template for amplification of chitinase cDNA , using insect chitinase -specific oligonucleotide primers. Insect chitinase cDNA amplified this way was cloned in PCRII cloning vector ( Invitrogen ). The amplified products were separated on a 1% agarose gel.

50. DNA manipulation and nucleotide sequence: Sequence determination was carried out by the dideoxy chain termination method using the PRISM sequence fluorescent dye-labeled dideoxy nucleotide kit (PE Applied Biosystem inc.) The complete nucleotide sequence of the ~1600 nucleotides-long coding region of chitinase cDNA was obtained using M13 forward 5′CTGGCCGTCGTTTTAC3′ and reverse 5′GTCGTGACTGGGAAAAC3′ primers in addition to one nested primer 5′ACTGACTGCTGCCGTACCACT3′ (549–569). Construction of plant expression vectors: The plasmid pChi -SB containing the bar gene as a selectable marker and insect chitinase was constructed.

51. The bar gene was cut from the plasmid pAB8 (4799bp) with HindIII and inserted in the HindIII site of pAHC25. The insect chitinase gene was also inserted in the plasmid pAHC25 by using EcoRI . Plant materials and culture initiation: Seeds from the desired maize genotypes were sown in the field at different intervals and were used as a continuous source of immature embryos as explants. A number of embryogenic maize genotypes have been selected for transformation experiments (Gz639, Gz624, Gz649, Gz650 and A188).

52. Maize ears were harvested from the field-grown plants, 10 to 15 days post pollination. Ears were surface sterilized (by treating with 5.25% hypochlorite with 0.1% TWEEN 20) and then washed three times with sterile distilled water. Immature embryos (1–1.5mm in length) were aseptically excised as described previously and incubated for 4 to 7 days at 25°C on N6-based callus induction medium (N6-Ag) containing 1.7mg/l silver nitrate and 2% sucrose .

53. Particle bombardment and selection: The gene gun was used for the transformation of maize explants. Four hours before bombardment, embryos were placed in the center of the plates containing osmotic medium. The osmotic treatment was continued for 16hours after bombardment. Embryogenic scutellar tissues were bombarded once at 1100psi with sterilized gold particles coated with plasmid DNA . Transformed maize tissues were incubated in darkness at 25°C for four days. Selection process was carried out by transferring the bombarded embryos to N6-Ag medium containing 2mg/l bialaphos for four weeks for selection of calli expressing the bar gene selectable marker with one subculture.

54. Maize regeneration: After four rounds of selection, bialaphos -resistant calli were regenerated by transferring them to regeneration medium, RM1, followed by RM2 (containing 3mg/l bialaphos ) and were incubated under fluorescent light (250μmol m –2 s –1 ). The regenerated shoots were rooted on RM3 medium containing 3mg/l bialaphos . Putatively transgenic plantlets were acclimatized in the biocontainment green house. Healthy rooted plantlets were transferred to pots containing a mixture of peat moss: soil (1:1).

55. RESULTS AND DISUSSIONS: Chitinases are present in high concentrations in cereal grains known to be nontoxic to plants and gene have shown enhanced resistance to insect feeding in many studies,because of its capacity to degrade the linear polymer of chitin consisting of β-1,4-linked N- acetylglucosamines.Hence transgenic crop overexpressing the insect chitinase are protected from the pathogenic fungi and pest insects. First studies that evaluated insect resistance of transgenic plants expressing an insect chitinase utilized transgenic tobacco plants and European corn borer. In this study, the expression level of insect chitinase was found to be low, but even then the mortality rate of European corn borer was found significant when compared with the wild type. However no significant mortality was observed on M. sexta larva feeding on same transgenic tobacco line. The reason for this was attributed to the thickness of PM in case of M. sexta compared to European corn borer.

56. CONCLUSION: we have generated transgenic maize plant that overexpresses an insect chitinase . The chitinase cDNA from S. littoralis was isolated and transferred in different genotype of maize plant widely grown in Egypt. The expression of transgenic insect chitinase was observed and found to be overexpressed in regenerated transgenic maize. The insect resistance was also found to be significantly improved in the case of transgenic maize plant. This study is the first attempt to improve the maize productivity in Egyptian maize varieties so that farmers will get maximum benefits by protecting the crops in the field as well as during storage of grains.

57. SUBMITTED TO, Dr.K.B.ESWARI , ASSOCIATE PROFESSOR DEPT OF GENETICS AND PLANT BREEDING. Submitted by , B.Rachana , RAM/16-45.