synthetic apomixis by gene editing

This presentation describes about approaches to engineer apomixis, an alternative of sexual pathway, in major food crops for fixation of hybrid vigor through clonal seeds.

1. KIRAN K.M PGS20AGR8449 Department of genetics and plant breeding MASTERS SEMINAR II UNIVERSITY OF AGRICULTURAL SCINECE, DHARWAD Synthetic Apomixis by genome editing : An Approach to fix hybrid vigour

2. This [hybrid rice] technology is not for farmers who are still struggling at the level of 2 or 3 tons per hectare. – S.S. Virmani , IRRI, 1998 Is benefit of “hybrid technology” reach up-to bottom hands ?

3. Is it possible to fix hybrid vigour ?

4. Parthenogenesis Initiation of endosperm development with or without fertilization APOMIXIS Apomeiosis F1 HYBRID But,..IS IT THAT MUCH EASY TO ACHIEVE STABLE APOMIXIS ?

5. Our way through… How to capture MiMe technology ? : Mine out the genetic control Introduction : A general look into apomixis mechanism Where should tap to induce apomeiosis ? How to hold hybrid heterozygosity over generations though seeds ? : Idea of Clonal fix strategy What are approaches to achieve parthenogenic development of MiMe gametes What are the hurdles ahead to overcome ? Conclusion

6. Sporophyte apospory Apospory Amphimixis Diplospory Classification of apomixis

7. An apospory-specific genomic region is conserved between Buffelgrass (Cenchrus ciliaris L.) and Pennisetum squamulatum Fresen . Buffelgrass (Cenchrus ciliaris L.) Apomixis is transmitted by a large non-recombining chromosomal region named the apospory-specific genomic region (ASGR) contains multiple copies of PsASGR -BABY BOOM-like ( PsASGR -BBML; Pennisetum squamulatum Taraxacum officinale DIP locus : Diplospory PAR locus : Parethenogensis In apomictic plant, apomixis is restricted to female meiosis only

8. Boechera retrofracta APOLLO (apomixis-linked locus) : Have apoalleles ’ and ‘ sexalleles ( heterozygous ) in apomictic Boechera spp . sexual genotypes : Homozygous for sex alleles UPGRADE2 (unreduced pollen grain development) Three independent loci, LOA : to control Apospory, LOP : To control parthenogenesis AutE : To control Autonomous endosperm :Sexual and apomictic seed formation in Hieracium requires the plant polycomb -group gene FERTILIZATION INDEPENDENT ENDOSPERM Hieracium (HAWK WEED)

9. Apomixis is a Consequence of Developmental Asynchronies Apomixis is a Mutation-Based Phenomenon Apomixis is an Ancient Switch, Polyphenic to Sex, and Epigentically Regulated The Molecular Basis of Apomixis Apomixis depends on alteration of different species-specific genes controlling and/ or co-ordinating developmental steps within reproductive modules to produce genetically balanced clonal progeny

10. Non- Coding RNA Transposable elements Pseudogenization Hyper- hypo methylation Cell-specific expression of genes MITE transposon insertion in the promoter region of the candidate gene ( CitRWP ) controlling sporophytic apomixis in Citrus. Apomictic dandelion (Taraxacum officinale) and hawkweed (Hieracium piloselloides ) carry MITE transposons in the upstream region of parthenogenesis gene (PAR) Gene regulation at natural apomixis-associated loci

11. Transcriptome comparison of apomictic Boechera , Hieracium and Hypericum with related sexual lines revealed changes in siRNA synthesis and RdDM related gene expression Epigenetic control over apomixis The analysis of Arabidopsis mutant ovule epigenetically controlled by sRNA-mediated silencing pathway involving ARGONAUTE 9 (AGO9) protein showed transition from sexual to apomictic-like phenotype. The regulation of MEDEA (MEA) gene involved in the control of fertilization-independent development of endosperm is associated with the epigenetic regulatory polycomb repressive complex 2 (PRC2), which silencing of gene expression via trimethylation of histone H3 at lysine 27 (H3K27me3 (Schmidt A, 2013 )

12. 1)Mimicking Gametophytic apomixis 2) Mimicking Sporophytic apomixis Producing unreduced non recombinant gametes (either by skipping meiosis or by blocking the reductional division of meiosis), Develop an embryo parthenogenetically Promoting endosperm development to complete the formation of a seed. Inducing an ectopic embryo within the ovule Arresting or delaying egg cell progression or zygote development in the fertilized meiotic female gametophyte Approach to engineer Synthetic apomixis

13. Pachytene Telophase I Dikakinesis Metaphase I Anaphase I Pachytene osd1 mutants skip meiosis II - Arabidopsis thaliana Turning meiosis into mitosis D’Erfurth et al.,

14. Osd1 Mutants Produce Diploid Gametes by Skipping the Second Meiotic Division

15. Mutation that eliminates recombination and pairing (Atspo11-1) Mutation that modifies chromatid segregation (Atrec8)

16. A genotype in which meiosis is totally replaced by mitosis without affecting subsequent sexual processes . : MiMe for ‘‘mitosis instead of meiosis MiMe Technology- Turning meiosis into mitosis The three genes conferring the MiMe genotype are strongly conserved among plants, suggesting that apomeiosis may be engineered in any plant species

17. Conclusion First, spo11-1 abolishes meiotic recombination Second, the mutation of REC8 causes the separation of sister chromatids at first meiotic division, instead of the distribution of homologous chromosomes osd1 causes the skipping of the second meiotic division Doubling of ploidy of MiMe genotype after at each generation when self-fertilized Dugout other genes involved in the meiosis process – MiMe generation Check feasibility in other crops: Commercial crops Need to unravel genetic mechanism of parthenogenic development of MiMe gametes and endosperm development Steps ahead

18. Gene Gene product/function Reference dmc1 Involved in meiotic recombination. Mutants of DMC1 exhibit defective in meiotic double strand break formation Couteau et al., 1999 ahp2 involved in bivalent formation and homologous chromosomes segregation Schommer et al., 2003 scc3 SCC3 protein is essential for the maintenance of the centromere cohesion Chelysheva et al., 2005 asy1 ASY1 plays an essential role in homologous chromosome synapsis. Caryl et al., 2000 tdm1 TDM1 is essential for meiotic termination after meiosis II. Cifuentes et al., 2016 TAM/CYCA1;2 Type-A cyclin required for the transition of meiosis I to meiosis II D’Erfurth et al., 2010 Genes and their related functions involved in Apomeiosis

19. Gene Species Gene product/function Reference DYAD/SWI1 (SWITCH 1) Arabidopsis Regulator of meiotic chromosome organization & sister chromatid cohesion Ravi et al ., 2008; Mercier R., 2001 AM1 AtSPO11-1 Maize Arabidopsis SWI1 ortholog Topoisomerase-like transesterase Pawlowski et al ., 2009 , Grelon , 2001 AtSPO11-2 AtREC8 Arabidopsis Arabidopsis AtSPO11-1 paralog Arabidopsis Cohesin necessary for centromere cohesion and kinetochore orientation Stacey et al ., 2006 Chelysheva et al ., 2005 OsREC8 OsOSD1 Rice i ) A key component of the meiotic cohesion complex ii) Cause omission of M-II division Mieulet et al ., 2016 PAIR1 Rice Essential protein for the initiation of meiotic recombination Nonomura et al ., 2004

20. Genes essential for DSB formation in plants . SPO11-1, and SPO11-2, HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS1 (PAIR1), PUTATIVE RECOMBINATION INITIATION DEFECT1 (PRD1), PUTATIVE RECOMBINATION INITIATION DEFECT2 (PRD2), MEIOTIC TOPOISOMERASE VIB–LIKE (MTOPVIB), DSB FORMATION (DFO), CENTRALREGION COMPONENT 1 (CRC1)

21. Identified of Ososd1 ( Oryza sativa OSD mutation) mutant in rice from Oryza Tag Line insertion line insertion library Generated MiMe in rice Turning rice meiosis into mitosis Mieulet et al., 2016 Cell research Does MiMe technology could generated in Rice ? Ososd1 mutation + Meiotic recombination + suppression mutation Chromatid segregation modifying recombination /Sister chromatid separation mutation pair1-4 Osrec 8-3

22. The single mutants pair1, Osrec8 and the double mutants pair1 Osrec8 and pair1 Ososd1 plants were fully sterile. In contrast, the pair1 Osrec8 Ososd1 triple mutant showed higher fertility, similar to Ososd1 single mutant like in Arabidopsis, the combination of pair1, rec8 and osd1 mutations turns meiosis into mitosis in rice known as OsMiMe genotype

23. Crossing made to construct triple mutant MiMe TIDIOUS TASK

24. Gene knockout for MiMe creation

25. Does MiMe technology alone enough to hold heterotic potential indefinitely ? ? cv cv cv cv 1) Uniparental genome Genome elimination 2) Induced parthenogenesis

26. Genes involved in haploid induction Gene Description crop cenh3 Alteration of centromere-specific histone CENH3 can induce genome elimination and haploid formation Arabidopsis MTL1 MTL1 encodes a pollen-specific phospholipase which is involved in fertilization. Mutation of MTL1 gene can induce haploid formation Maize DMP DOMAIN MEMBRANE PROTEIN Another gene expressed specifically in pollen,(Zhong et al., 2019). Loss-of-function mutations in Arabidopsis DMP8 and DMP9 trigger haploid induction (Zhong et  al., 2020) Maize, Eudicots , monocots

27. Genes involved in parthenogenesis Gene Description crop PAR The dominant PAR allele of dandelion is specially expressed in egg cells and can trigger embryogenesis without fertilization Taraxacum msi1 MSI1 gene functions in chromatin assembly. Mutants of MSI1 can produce parthenogenetic embryos Arabidopsis ASGR-BBML Expressed in unfertilized egg cells of apomictic Pennisetum squamulatum and activation of its expression in sexual pearl millet can also trigger parthenogenesis Pennisetum, Cenchrus

28. Their HI-inducing modification involved adding an N-terminal GFP tag to a fusion of the histone 3.3 tail with the CENH3 histone fold domain Dissimilar centromere behave differentially during cell division Centromere histone-3 (CENH-3) mediated haploid induction

29. Efficient elimination line for diploid gametes GEM Line : Genome Elimination caused by a Mix of CENH3 variants Arabidopsis ; MiMe plants were a mixture of Col-0 from Atspo11-1-3/Atrec8-3 and No-0 from osd1-1 (S1 ). cenh3-1 GFP- tailswap cenh3-1 GFPCENH3 cenh3-1 GFPCENH3 cenh3-1 GFP- tailswap Marimuthu et al. , 2010 MiMe coupled with genome elimination

30. Analysis of crosses between GEM and MiMe or dyad . Up to 34% of the progeny were clones of their parent, demonstrating the conversion of clonal female or male gametes into seed Although not fully penetrant, this demonstrates clonal propagation through seed in a manner akin to the outcome of apomixis.

31. Genotype analysis of MiMe x GEM and GEM x MiMe offspring . . The maternal diploids (diploid eliminants) retained the heterozygosity of the mother plant at all tested loci Lower seed set low and the trait was not fully penetrant (24–42% diploids)

32. CRISPR/Cas9-mediated deletions/ manipulating a single centromere protein, the centromere-specific histone CENH3 in CENH3 lead to haploid induction on outcrossing The CRISPR/Cas9-mediated deletions in the a N helix terminal can induce haploids opens a new avenue for the generation of haploid-inducing lines. [ lower HI rate -0.065–0.86% in maize] Single amino acid substitutions in the histone fold domain of CENH3 lead to haploid induction-[frequency as high as 44%] (Karimi- Ashtiyani et al., 2015; Kuppu et al., 2015). Requirement of separated crossing with F1 hybrid plant each time is not entertained

33. Genes responsible of haploid induction in maize stock 6 have been identified as a defect in Matrilineal, a spermspecific phospholipase gene- GRMZM2G471240 (MATRILINEAL)  4-bp insertion (CGAG) in the induction lines compared to the B73 genome The mutation of the MATRILINEAL (MTL) gene (also known as NOT LIKE DAD and PHOSPHOLIPASE A1 ), which encodes a spermspecific phospholipase, triggers haploid induction in maize DOMAIN MEMBRANE PROTEIN (DMP), another gene expressed specifically in pollen, can lead to independent haploid induction inmaize (Zhong et al., 2019). Haploid Induction by genetic disruption of MTL or DMP - option for paternal genome elimination

34. 2019 Combine fixation of heterozygosity and haploid induction by simultaneous editing of all four genes (REC8, PAIR1, OSD1 and MTL) in hybrid rice and obtained plants that could propagate clonally through seeds ‘Chunyou84’ (CY84) Inter-subspecific hybrid rice Chunjiang 16A (16A) Japonica male-sterile line Paternal C84 Indica-japonica intermediate-type line

35. The triple mutant of REC8, PAIR1 and OSD1 meiosis genes- MiMe (Mitosis instead of Meiosis Editing the MATRILINEAL (MTL) gene (involved in fertilization)- Induce paternal genome elimination

36. 1) To test the feasibility of MiMe technology in hybrid rice varieties CRISPR–Cas9 vector targeting OSD1, PAIR1 and REC8 Simultaneously edited the REC8, PAIR1 and OSD1 genes in the hybrid CY84 using multiplex CRISPR–Cas9 system9 Observed chromosome segregation pattern Analysis of ploidy of spores – FISH analyses using a 5 S rDNA-specific probe, which identifies chromosome 11 of rice Ploidy analysis flow cytometry ten insertion-deletion (indel) markers analysis Hybrid CY84

37. The chromosomes of CY84 and MiMe were probed by digoxigenin-16-dUTPlabeled 5 S rDNA (red signal, indicated with a white arrow) in spores, showing one signal in wild-type CY84 and two signals in MiMe . The DNA is stained with 4′,6-diamidino-2-phenylindole (DAPI, blue signal)

38. Panicles of wild-type CY84 and MiMe . The fertility of MiMe was as high as that of wild-type CY84 Panicles and grain shape of CY84 and the progeny of MiMe . The progeny of MiMe displayed reduced fertility, increased glume size and elongated awn length.

39. Ploidy analysis of the progeny of CY84, MiMe

40. 2) Generation of a haploid inducer line by editing the MTL gene in hybrid rice variety CY84 Normal vegetative growth, but the seed-setting rate was reduced to 11.5%

41. Twelve indel markers (one per chromosome) that were polymorphic between the two parents were used to determine the genotype of the progeny of the mtl plants. 11 plants from 248 mtl progeny appeared to be homozygous for all markers- HI rate= 4.4% Plants homozygous at all markers in the progeny siblings of mtl were identified as haploid or DH.

42. Flow cytometry showed that nine of these plants were indeed haploid, whereas two were diploid, presumably resulting from spontaneous doubling of haploid embryos.

43. Whole-genome sequencing of the haploid, DH and RID plants. Twelve blocks represent 12 chromosomes. The SNPs of C84 allele are in red, the SNPs of 16 A allele are in blue, and the coexistence of both alleles is in yellow Simultaneous editing of REC8, PAIR1 and OSD1 genes did not have obvious adverse effects on the growth and reproduction of the hybrid. The MTL gene used to induce paternal genome elimination had Negative effects on hybrid fertility Not fully penetrant

44. 3) Simultaneous editing of all four genes (REC8, PAIR1, OSD1 and MTL) in hybrid rice Combined fixation of heterozygosity and haploid induction Fix plants displayed a reduced fertility( 4.5% ) due of the MTL mutation The Fix plant was able to produce clonal seeds with the same ploidy and heterozygous genotype

45. The clonal Fix ( Diploid progeny of Fix ) displayed a low seed-setting rate that was similar to that of parent Fix plant Improvements in fertility, such as by modifying the MTL gene or looking for different haploid-inducing genes, will be required technology or clonal fix technology to be commercialized for rice.

46. Plant and panicle morphology of diploid fix offspring plants

47. Ploidy analysis of the progeny of CY84, MiMe , mtl and Fix 79.1 % 81.8 % 11.5% 4.5%

48. Conclusion

49. Ectopic Expression of BBM Induces Somatic Embryo Formation in Arabidopsis and Brassica . Boutilier et al., 2002 The BABY BOOM (BBM) AINTEGUMENTA-LIKE (AIL) AP2/ERF domain transcription factor is a major regulator of plant cell totipotency, as it induces asexual embryo formation when ectopically expressed BBM genes from Arabidopsis thaliana and Brassica napus can ectopically induce somatic embryos; however, a role for these genes in the initiation of zygotic embryos has not been established.

50. Pennisetum squamulatum The large non-recombining ASGR transmitting apomixis contains multiple copies of PsASGR -BABY BOOM-like ( PsASGR -BBML ; Gualtieri et  al., 2006 ASGR  An APETELA 2 (AP2)-domain-containing gene and member of the BBML clade of the AINTEGUMENTA-LIKE (AIL) gene family PsASGR -BBML express in egg cells before fertilization and induces parthenogenesis BBML gene expression under the control of its own promoter in sexual pearl millet yielded haploid embryos (Conner et  al., 2015). PsASGR -BBML can induce parthenogenesis under the control of either its own promoter or an Arabidopsis egg-cell-specific promoter [DOWNREGULATED IN dif1 45 (DD45), At2g21740], which drives gene expression in egg cells in monocot crops, such as maize, rice ( Joann A. Conner, 2017 )   and in sorghum Induced Parthenogenesis of MiMe gamete

51. 1 Department of Plant Biology, University of California, Davis, CA, USA. 2 Innovative Genomics Institute, Berkeley, CA, USA. 3Department of Genetics, Development and Cell Biology, Iowa State University, Ames, IA, USA. Nature, 2018 Rice cultivar Kitaake (O. sativa L. subsp. japonica) Halfstrength Murashige and Skoog’s (MS) medium containing 1% sucrose and 0.3% phytagel in a growth chamber for 12 days, under a 16 h light:8 h dark cycle at 28 °C and 80% relative humidity. To make the ectopic expression of BBM1 in the rice egg prior fertilization to induce parthenogenesis Combining egg cell expressed rice BBM1 with CRISPR/Cas generated MiMe knockouts

52. Does parent of origin have effect on embryogenesis ? Pointed multiple BBM-like genes in rice, at least three— BBM1, BBM2 and BBM3 (Os11g19060, Os02g40070 and Os01g67410, respectively) CRISPR–Cas9 system to generate bbm1 bbm3 and bbm2 bbm3 double mutant (NO triple mutant obtained) BBM1/bbm1 bbm2/bbm2 bbm3/bbm3 plants were recovered and selfed viability of the bbm1 bbm2 bbm3 triple-mutant seeds was severely affected (2 out of 191 viable compared with the expected 48 out of 191 Performed reciprocal crosses of BBM1/bbm1 bbm2/bbm2 bbm3/bbm3 to BBM1/BBM1 bbm2/bbm2 bbm3/bbm3 plants

53. BBM1/BBM1 bbm2/bbm2 bbm3/bbm3 bbm1 /BBM1 bbm2/bbm2 bbm3/bbm3 Female Male X BBM1/BBM1 bbm2/bbm2 bbm3/bbm3 Male bbm1 /BBM1 bbm2/bbm2 bbm3/bbm3 Female X Result of maternal transmission of bbm1 allele Result of paternal transmission of bbm1 allele

54. Paternal expression of BBM1 in zygotes Expression of BBM1 fused to a GFP reporter was detected by antibody staining. GFP expression is observed only when BBM1–GFP is transmitted by the male parent

55. Male-genome-derived expression of BBM1—acting redundantly with other BBM genes—triggers the embryonic program in the fertilized egg cell. Subsequent activation of expression of the female BBM1 allele by the male BBM1 results in biallelic expression, with both parental alleles eventually contributing to embryo patterning and organ morphogenesis The embryo arrest and abortion due to triple knock down of the genes BBM1, BBM2, and BBM3 were fully rescued by the male transmitted BBM1

56. Parthenogenesis induction by expression of BBM1 in the egg cell. T-DNA region of the binary vector The expression of BBM1 in the egg cell initiated parthenogenesis in emasculated flowers , but the seeds aborted in the absence of endosperm . Agrobacterium mediated transfer of the construct into rice egg cell (BBM1- ee transgenic plant) Cloning BBM1 downstream to Arabidopsis DD45 promoter and upstream of the nopaline synthase terminator in pCAMBIA1300 .

57. Development of parthenogenetic embryos (red arrowhead) by egg-cell-specific expression of BBM1 in carpels of an emasculated BBM1-ee plant at nine days after emasculation. In the absence of fertilization, endosperm development is not observed (black arrow). In fertilized control wild-type (4 days after pollination (DAP)) carpels, the development of both embryo and endosperm is observed

58. 3n 2n n + n n+n n 3n n Non viable/ non endospermous Viable Diploid Viable haploid- Parthenogenic Transgenic plant

59. Analysis of Self-pollinated T1 progeny from BBM1-ee transgenic plants Self-fertilization produce viable seeds( Endosperm development ) containing parthenogenetically derived haploid embryos . Haploids  S mall size compared with their diploid siblings, as well as by their sterile flowers owing to defective meiosis The haploid induction frequency was 5–10% (T1 plants) and reached around 29% in homozygous T2 line 8C —this frequency was maintained through multiple generations A BBM1-ee parthenogenetic haploid panicle showing no anthesis Check for haploid viable seeds (Endo-spermous)

60. Pollen viability in haploids was assessed by Alexander staining . BBM1-ee haploid anther with non-viable pollen wild-type anther with viable pollen

61. The expression of BBM1 in the egg cell can initiated parthenogenesis in emasculated flowers  haploid inducer homozygous T2 line 8C ( around 29% ) Inference The genome editing to substitute mitosis for meiosis ( MiMe ) should combined with the expression of BBM1 in the egg cell for asexual propagation via seeds to retain genome-wide parental heterozygosity The next step forward ?

62. Material and Method Schematic of the CRISPR–Cas9 plasmid construct used for genome editing of the three MiMe rice genes. pCAMBIA2300 MiMe CRISPR–Cas9 was transformed in embryogenic calli derived from pDD45::BBM1#8c haploid inducer lines Rice cultivar : Kitaake ( O. sativa L. subsp. japonica ) Three candidate genes ( OSD1 , Os02g37850 ; PAIR1 , Os03g01590 and REC8, Os05g50410 ) for creating MiMe mutations in rice were selected and sgRNAs sequences 5′-GCGCTCGCCGACCCCTCGGG-3′, 5 ′-GGTGAG GAGGTTGTCGTCGA-3 ′ and 5′- GTGTGGCGATCGTGTACGAG -3′, respectively, for CRISPR–Cas9-based knockout Schematic of genome integrated pDD45::BBM1 in the BBM1-ee plant

63. Haploid BBM1-ee plant + MiMe Haploid embryo FERTILE n n n MMC of Haploid BBM1-ee plant NO recombination and reduction division ( MiMe ) Parthenogenic development of egg cell egg cell The three rice MiMe genes were subject to genome editing by CRISPR–Cas9 in haploid and diploid plants carrying the BBM1-ee transgene. Unlike BBM1-ee haploids, the MiMe + BBM1-ee haploids were fertile with normal anther development, suggesting that meiosis was successfully replaced by mitosis Self pollination Diploid (Double haploid ) Haploid ( S-Apo ;Synthetic-Apomictic ) <few plants only> Embryo/ Haploid progeny T0 T1

64. Study found haploid progeny from two MiMe + BBM1-ee (Synthetic-Apomictic) haploid mother plants at frequencies of 26% and 15%, due to parthenogenesis These haploid induction frequencies were maintained for the next two generations. These results show that haploid S-Apo plants can be propagated asexually through seeds. Diploid + Tetraploid T0 – Transgenic plant/ MiMe Haploid T1 Diploid (Double haploid ) Haploid ( S-Apo ;Synthetic-Apomictic ) Asexual reproduction T2 Sexual reproduction

65. T0 – Transgenic plant/ Diploid MiMe MiMe Tetraploid S-Apo Diploid ( S-Apo ;Synthetic-Apomictic ) Diploid BBM1-ee plant + MiMe  Di ploid embryo Obtained diploids at frequencies of 11% and 29% from the progeny of two diploid S-Apo (that is, MiMe + BBM1-ee) T0 transformants and rest tetraploids T1

66. MiMe mutations and confirmation of clonal progeny from S-Apo plants. a, Sequence chromatograms at mutation sites of MiMe genes in wild-type, T0 diploid S-Apo mother plant and two diploid progeny from each of T1, T2 and T3 generations of S-Apo line 1 (n = 7). Red arrows point to mutation sites. PAIR1 and REC8 are biallelic whereas OSD1 is homozygous

67. Asexual propagation without genetic segregation can be engineered in a sexually reproducing plant, and illustrates the feasibility of clonal propagation of hybrids through seeds in rice The maternal : paternal genome ratio of 2:1 is maintained in the endosperm in both the pathways, ensuring normal seed development. Conclusion

68. Mimicking sporophyte apomixis Ectopic embryo induction within the ovule Arresting or delaying egg cell progression or zygote development in the fertilized meiotic female gametophyte The complete arrest of zygote development will impose arrestment of the endosperm and seed failure due to embryo-endosperm signaling and communication Gene Description crop RWP CitRWP gene is co-segregated with citrus nucellar embryo and preferentially expressed in nucellar embryo initiation cells. Citrus AGL11 MADS-box transcription factor, expressed at the apomictic nucellar embryo stage . Zanthoxylum bungeanum BBM Transcription factor Brassica

69. Genetic analysis in citrus revealed, somatic embryogenesis is likely regulated by the gene CiRKD1 , which encoding an RWP-RK domain-containing transcription factor CitRKD1 at the polyembryonic locus comprised multiple alleles that were divided into two types, polyembryonic alleles with a MITE insertion in the upstream region and monoembryonic alleles without it. Additionally, a C2H2 zinc-finger domain-containing transcription factor gene ( CitZFP ), which is homologous to the dandelion parthenogenesis gene (PAR), is specifically expressed in apomictic cells. Xia Wang e t al ., 2017 This indicates further study on the function and regulation of CitRWP and CitZFP genes in citrus are necessary for utilization of sporophytic apomixis in apomixis breeding

70. Autonomous endosperm in sexuals is complex process rely on genome balance, epigenetic gene regulation, parent-of-origin effects founded upon the contribution of the male gamete, and regulatory pathways underlying embryo-endosperm developments Maternally expressed polycomb repressive complex 2 (PRC2), which catalyzes histone H3 lysine 27 methylation ( H3K27me3 ) to repress gene expression, involved in the control of endosperm development Mutations in fertilization independent endosperm (FIE) and other Polycomb group genes leading to Autonomous endosperm development in Arabidopsis Orthologs reported in both rice (OsFIE1 and OsFIE2) and maize (ZmFIE1 and ZmFIE2) produce distinct phenotypes. Autonomous endosperm development

71. Genes involved in endosperm development Gene Description crop ORC3 Defective ORC3 mutants exhibit normal female gametophyte but the development of embryo and endosperm is abolished. Paspalum FIE The expression of FIE is negatively correlated with parthenogenesis capacity. Mutant of FIE allows endosperm development without fertilization. Malus, Arabidopsis fis FIS controls seed development after double fertilization. In the fis mutants, partial development of seed can occur without pollination Arabidopsis

72. Autonomous endosperm development Using Cas9 as a recruiting platform for demethylase would allow activation of repressed female genes, for instance to erase genomic imprinting and trigger autonomous endosperm

73. Tonosaki K, 2020 This study, demonstrate that mutation of the rice (Oryza sativa) gene EMBRYONIC FLOWER2a (OsEMF2a) , encoding a zinc-finger containing component of PRC2 , causes an autonomous endosperm phenotype involving proliferation of the central cell nuclei with separate cytoplasmic domains, even in the absence of fertilization A CRISPR/Cas9 guide RNA sequence targeting 10th exon of OsEMF2a that encodes a zinc-finger domain OsU6pro:sgRNA:polyT  binary vector: pZH_OsU3gYSA_MMCas9 harboring SpCas9 and hygromycin phosphotransferase gene (HPT) expression constructs using AscI and PacI site

74. Multiple nuclear cytoplasmic domains were present in the enlarged cavity of the embryo sac in emf2a-3/ + plants at 4 DAE Accumulation of starch grains and protein storage vacuoles (Double stained with iodine and safranin)

75. Gene expression profile of emf2a autonomous endosperm without fertilization

76. Maternal OsEMF2a is involved in seed development after fertilization Reciprocal Crosses Normal seeds Shriveled seeds Wild-type X emf2a-3/+ 97.73% 2.27% emf2a-3/+ X Wild-type 62.50% 37.50% Wild-type X emf2a-5/+ 100.00% 0.00% emf2a-5/+ X Wild-type 64.29% 35.71% Does OsEMF2a gene involved in other functions ? emf2a / +  selfing OsEMF2a controls the timing of cellularization : Delayed development Coenocytic endosperm showed unusual vacuolated structures and centripetal proliferation without cellularization , especially at the embryo periphery

77. OsEMF2a targets MADS-box transcription factor genes Transcriptome and H3K27me3 ChIP -seq analyses using endosperm from the emf2a mutant identified downstream targets of PRC2. These included 4100 transcription factor genes such as type-I MADS-box genes( OsMADS77 and OsMADS89; ), which are likely required for endosperm development. EMBRYONIC FLOWER2a-containing PRC2 controls endosperm developmental programs both before and after fertilization. Identifying key regulators that repress nuclear divisions in the central cell and the developmental transitions in endosperm will require more detailed investigations further to achieve full benefit Inference

78. Current hurdles to exploit synthetic apomixis The MiMe combined with CENH3 system depends on hybrid pollination , which restricted the commercial production of clonal seed. In both MiMe combined with MTL1 system and MiMe combined with BBM1 system , the clonal seeds exhibit relatively low fertility , possibly due to the low frequency of parthenogenesis, The MiMe combined with BBM1 system requires self-pollination to initiate endosperm development and thus sexual seeds are also produced together with the clonal seeds. MiMe + BBM1  include transgene BBM promoter, and it leak through pollen into environment Lower expressivity penetrance and fertility of clonal fix seeds

79. Gene Combination Reproductive Phenotype Expressivity Fertility AtSPO11-1 + AtREC8 + AtOSD1 Unreduced nonrecombinant gametes 1.00 0.66 OsPAIR1 + OsREC8 + OsOSD1 Unreduced nonrecombinant gametes 1.00 0.74 AtSPO11-1 + AtREC8 + AtOSD1 + GEM Clonal offspring (mixed) 0.33 0.3 dyad + GEM 4 Clonal offspring (mixed) 0.13 0.0018 AtSPO11-1 + AtREC8 + AtOSD1 + BBM1 Clonal offspring (mixed) 0.11–0.29 ? OsPAIR1 + OsREC8 + OsOSD1 + OsMATL Clonal offspring (mixed) 0.02–0.04 0.045 OsSPO11-1 + OsREC8 + OsOSD1 + OsMATL Clonal offspring ? ? APOMIXIS : Need to tune for complete penetrance High expressivity and Fertility

80. Modify different genes to mimic apomixis- like steps Optimizing fittest combination of mutants Maximum trait expressivity Modulate gene expression

81. Asexual propagation through synthetic apomixis should extend to most cereal crops. The efficiency of clonal propagation inculding , frequency of parthenogenesis , which could potentially be improved in the future with different promoters Minimizing endosperm imprinting effects specifically on endosperm development and starch mobilization Expand data collection for genomic dissection of apomixis loci to unfurl its secret: thus to maximize fertility clear regulatory network of each component of apomixis, cell-to-cell signalling will provide strong foundation for engineering of apomixis in crops Produce a fertile highly expressive apomict, with no off-target effects of gene editing. Future direction

82. CONCLUSION Knowledge on how genes are interconnected in different metabolic pathways will be important for editing different reproductive genes without disrupting the process that lead to a mature seed

83. THANK’s to science