1-Animal taxonomy, evolution and genomics (1).pptx

Biology 1st year

1. The place of Humans and other mammals within the tree of life and Genomics

2. Today Genomics Taxonomy and phylogenetics Sequencing Human genomics

3. Genomics Studying whole, (or large sections) genomes in terms of the molecular sequences Genome is the combined genetic information of an organism Chromosomes and smaller sections of DNA (plasmids mtDNA ) Genetics vs genomics?

4. Genomics revolutionised Biology! Whole genome sequencing gives insight in: Molecular working of organisms Diseases and disorders Diversity in populations Forensics Evolution, history and taxonomy

5. Classical Taxonomy and comparative anatomy Campbell biology https://openstax.org/books/biology-2e/pages/18-1-understanding-evolution

6. Homologous structures share a similar embryonic and or evolutionary origin; Analogous organs have a similar function and therefore look superficially similar. Example: the bones in the front flipper of a whale are homologous to the bones in the human arm. These structures are not analogous. The wings of a bee and the wings of a bat are analogous but not homologous. Some structures are both analogous and homologous: the wings of a bird and the wings of a bat are both homologous and analogous. These effects can also happen on the molecular level! https://bio.libretexts.org/ (credit a: modification of work by Steve Hillebrand, USFWS; credit b: modification of work by U.S. DOI BLM; credit c: modification of work by Jon Sullivan)

7. Margaret Oakley Dayhoff Bioinformatics: Comparative genetics and phylogeny

8. Bioinformatics: Comparative genetics and phylogeny Species4 CACCCTATCGCGTACGTACGTGTC Species5 CACCCTATCGGGTACGTACGTGTC Species3 AAATTTATCGCGTACGTACGTCCA Species1 AAATTTATCGCGTACGTACGTGTA Species2 AAGTTTATCGCGTACGTACGTGTA * ***** **********

9. Walk through the tree of life

10. Primates Apes Hominidae

11. Mammals Mammals: Mammary glands: milk Hair A larger brain than other vertebrates of equivalent size Differentiated teeth Three bones in the ear

12. Amniota Libre text

13. Tetrapoda and bony fishes

14. Deuterostomes (Chordates and Echinodermata) Lobed fins Legs Amniotic egg Milk, Hair Jaws, mineralized skeleton Lungs or lung derivatives Vertebral column C ranium Notochord Common ancestor of chordates ANCESTRAL DEUTERO- STOME Echinodermata (sister group to chordates) Chondrichthyes (sharks, rays, chimaeras) Cephalochordata (lancelets) Urochordata (tunicates) Myxini (hagfishes) Petromyzontida (lampreys) Mammalia (mammals) Actinopterygii (ray-finned fishes) Actinistia (coelacanths) Amphibia (frogs, salamanders) Dipnoi (lungfishes) Reptilia (turtles, snakes, crocodiles, birds) Chordates Craniates Vertebrates Gnathostomes Lobe-fins Osteichthyans Tetrapods Amniotes Starfish and urchins Nhobgood  Nick Hobgood - Own work CC BY-SA 3.0

15. Bilateria, Odekunle & Elphick (2020) Frontiers in Endocrinology Comparative and Evolutionary Physiology of Vasopressin/ Oxytocin-Type Neuropeptide Signalling in Invertebrates 10.3389/fendo.2020.00225

16. Common ancestor of all animals True tissues Sponges (basal animals) Ctenophora Cnidaria Acoela (basal bilaterians) Deuterostomia Lophotrochozoa Ecdysozoa Metazoa Eumetazoa Bilateria (most animals) Bilateral symmetry Three germ layers Jelly fish, Sea anemones, corals Mollusca Annelida Nematoda Arthropoda

17. Choanozoa OTHER EUKARYOTES Choanoflagellates Sponges Other animals Animals Individual choanoflagellate Collar cell (choanocyte)

18. O pisthokonta Shabardina , V., Dharamshi, J.E., Ara, P.S. et al. Ichthyosporea : a window into the origin of animals. Commun Biol 7, 915 (2024). https://doi.org/10.1038/s42003-024-06608-5 Fungi Brunet et al. (2021)  A flagellate-to-amoeboid switch in the closest living relatives of animals   eLife   10 :e61037. https://doi.org/10.7554/eLife.61037

19. Eukarya Large multicellular organisms: Animals, Fungi, Brown Algae, and Red-, Green-, algae & Plants Slime Molds: Amoebozoans that sometimes become macroscopic and multicellular

20. Endosymbiotic origin of Eukaryotic cell Mitochondria are like aerobic bacteria in many ways. E.g. They have their own circular chromosome. Have bacterial type ribosomes Reproduce via (binary) fission. Chloroplast derive from cyanobacteria. Bentley 2020 Lynn Margulis Thijs Ettema Agard Archaea

21. Evolutionary mechanisms From the genetic perspective Evolution is the change over time in gene variant frequencies in the population. We will investigate that next time!

22. Why is this knowledge important? Understanding of taxonomy and evolutionary history help us understand biology and thus for instance: Choice of model organism Diseases and medication: Eukaryotic infections (such as Fungi) are harder to treat then bacterial partially because they are closer related to us. Anatomy Biotechnological decisions e.g. human like therapeutic antibodies production works better in animal cell lines of related species then in yeast or bacteria Evolutionary mechanisms help prevent or predict pathogen evolution and pandemics Guided evolution, selection, breeding I satisfies a deep curiosity in many people to know how we came to be us.

23. Other uses of sequencing and bioinformatics Medical genomics Genome Wide Association studies (GWAS) Specific genes Gene therapy Biotechnology Forensics History, ancestry, family bonds

24. History, geography and genomics Leslie, S., Winney , B., Hellenthal , G. et al. The fine-scale genetic structure of the British population. Nature 519, 309–314 (2015). https://doi.org/10.1038/nature14230 Irving-Pease, E.K., Refoyo -Martínez, A., Barrie, W. et al. The selection landscape and genetic legacy of ancient Eurasians. Nature 625, 312–320 (2024). https://doi.org/10.1038/s41586-023-06705-1

25. Sequencing The Human Genome Officially begun as the Human Genome Project in 1990, the sequencing of the human genome was largely completed by 2003 The genome was completed using sequencing machines and by systematically using the dideoxy chain termination method (Sanger) And also sequenced the entire genome using an alternative whole-genome shotgun approach

26. The Human Genome Most of the human genome is contained in the nucleus A very small portion of the genome is contained in the mitochondria (Circular chromosome) A human somatic cell contains 22 pairs of autosomes (non-sex chromosomes) and one pair of sex chromosomes Human females are XX, and males are XY

27. What is a Genome The genome is all the DNA in a cell. All the DNA on all the chromosomes Eukaryotes can have 2-3 genomes Nuclear genome Mitochondrial genome Plastid genome If not specified, “genome” usually refers to the nuclear genome.

28. Sequencing Sanger sequencing Nanopore sequencing Sequencing by synthesis High throughput and fast Longer sections can be done More error prone Low throughput, slightly less error prone, good for small sections Impractical for whole genome High throughput and Fast Short sections assembled to whole genome in the computer Only slightly more error prone

29. Chain termination sequencing (Sanger) Sanger sequencing

30. Polymerase chain reaction PCR 20 sec 97 ° C 20 sec 40-65 ° C 60 sec 7 5 ° C

31. Chain termination sequencing (Sanger) Sanger sequencing

32. Cut the DNA into overlapping fragments short enough for sequencing. 1 2 3 Clone the fragments in plasmid or other vectors. Sequence each fragment. CGCCATCAGT CGCCATCAGT AGTCCGCTATACGA ACGATACTGGT ACGATACTGGT AGTCCGCTATACGA ⋯ CGCCATCAGTCCGCTATACGATACTGGT ⋯ 4 Order the sequences into one overall sequence with computer software. Sequencing The Human Genome