introduction to Genomics

a branch of biotechnology concerned with applying the techniques of genetics and molecular biology to the genetic mapping and DNA sequencing of sets of genes.
*methods of genome sequencing
*advantages and disadvantages
*history of genomics
*types of genomics
*scope of genomics
*application of genomics

1. Genomics Iqra sami

2. What is Genomics? a branch of biotechnology concerned with applying the techniques of genetics and molecular biology to the genetic mapping and DNA sequencing of sets of genes 

3. Genomics The  human genome typically consists of 23 pairs of chromosomes and 24,000 genes. In medicine, genome and DNA sequencing -- determining the exact structure of a DNA molecule.

4. Genomics in genetics Genomics  is an area within genetics that concerns the sequencing and analysis of an organism's  genome . The  genome  is the entire DNA content that is present within one cell of an organism. 

5. Genomics in molecular biology The branch of molecular biology concerned with the structure, function , evolution and mapping of genomes.

6. Genome the genome is made of a chemical called DNA . The genome, contains genes which are packaged in chromosomes and affect specific characteristics of the organism. In short, the genome is divided into chromosomes, chromosomes contain genes, and genes are made of DNA.

7. Genomics Genome : the complete set of genes or genetic material present in a cell or organism. Gene :the hereditary unit specifying the production of discrete proteins or enzymes of RNA molecules. Chromosome : DNA molecule is packaged into thread-like structures called chromosomes. Each chromosome is made up of DNA tightly coiled many times around proteins called histones that support its structure.

8. Who coined the term genomics? Genomics was coined by Tom Roderick, a geneticist at the Jackson Laboratory (Bar Harbor, Maine) Genome term was coined German botanist  Hans Winkler  coined the term genome in 1920 by combining the words Gene and chromosome.

9. History of genomics DNA was first isolated as early as 1869, with technological advances happening in the 1950s, such as creating isotopes and radiolabel biological molecules. Also during this time, the description of the structure of the DNA helix was made by scientists James D. Watson and Francis H.C. Crick in 1953.

10. History of genomics The history of modern genomics really starts in the 1970s when the first genome was sequenced by biochemist Frederick Sanger . He sequenced the genomes of a virus and mitochondrion in the early 1970s. Sanger and his team also created techniques for sequencing, data storage, genome mapping and more. Another scientist who played an important role in modern genomics is Walter Fiers . In 1976, he and his research team from the Laboratory of Molecular Biology of the University of Ghent in Belgium were the first to establish the complete nucleotide sequence of a viral RNA-genome

11. History of genomics In 1990, the Human Genome Project, a publicly funded international genomics research effort to determine the sequence of the human genome as well as identify the genes it contains, was launched by the  National Institutes of Health and the U.S. Department of Energy. The goal of this group was to sequence and identify all three billion chemical units in the human genome . The purpose of this was to find the genetic roots of disease and help develop treatments. The Human Genome Project also aimed to make all human genome sequence information freely and publicly available within 24 hours of its assembly. The project was active for 13 years.

12. Difference between genetics and genomics genetics Genetics is the study of heredity, or how the characteristics of living organisms are transmitted from one generation to the next via DNA, the substance that comprises genes, the basic unit of heredity genomics Genomics, in contrast, is the study of the entirety of an organism’s genes – called the genome. Using high-performance computing and math techniques known as bioinformatics, genomics researchers analyze enormous amounts of DNA-sequence data to find variations that affect health, disease or drug response. Genomics is a much newer field than genetics

13. Genomics Genomics mainly relies: Genome sequencing Genome mapping Genome variation Gene therapy Genetic diseases. Human genome project.

14. Genome sequencing Genome sequencing is figuring out the order of DNA nucleotides, or bases, in a genome—the order of As, Cs, Gs, and Ts that make up an organism's DNA. The human genome is made up of over 3 billion of these genetic letters.

15. Early efforts in genome sequencing  Rosalind Franklin's confirmation of the helical structure of DNA James D. Watson and Francis Crick s publication of the structure of DNA in 1953  Fred Sanger s publication of the Amino acid sequence of insulin in 1955  Marshall Nirenberg and Philip Leder  revealed the triplet nature of the genetic code and were able to determine the sequences of 54 out of 64 codons in their experiment.

16. Genome sequencing The whole genome can't be sequenced all at once because available methods of DNA sequencing can only handle short stretches of DNA at a time. So instead, scientists must break the genome into small pieces, sequence the pieces, and then reassemble them in the proper order to arrive at the sequence of the whole genome. Sanger method was the basis of DNA sequencing.

17. Genome sequencing There are two approaches for genome sequencing Clone by clone sequencing Shotgun sequencing

18. Clone by clone sequencing During clone-by-clone sequencing, a map of each chromosome of the genome is made before the DNA is split up into fragments ready for sequencing. In clone-by-clone sequencing the genome is broken up into large chunks, 150 kilobases long (150,000 base pairs).  the chunks are then inserted into Bacterial Artificial Chromosomes (BACs) and put inside bacterial cells to grow. A bacterial artificial chromosome (BAC) is an engineered DNA molecule used to clone DNA sequences in bacterial cells

19. Clone by clone sequencing The chunks of DNA are copied each time the bacteria divide to produce lots of identical copies. The DNA in the individual bacterial clones is then broken down into even smaller, overlapping fragments.  These fragments are put into a vector that has a known DNA sequence. The DNA fragments are then sequenced, starting with the known sequence of the vector and extending out into the unknown sequence of the DNA.

20. Clone by clone sequencing Following sequencing the small fragments of DNA are pieced together by identifying areas of overlap to reform the large chunks that were originally inserted into the BACs. This ‘assembly’ is carried out by computers which spot areas of overlap and piece the DNA sequence together.

21. clone-by-clone The clone-by-clone approach was used during the 1980s and 1990s to sequence the genomes of the nematode worm,  C. elegans , and the yeast,  S. cerevisiae .

22. advantages of clone-by-clone sequencing Every fragment of DNA is taken from a known region of the genome, so it is relatively easy to determine where there are any gaps in the sequence. Assembly is more reliable because a genome map is followed so the scientists know where the larger fragments are in relation to each other. As each fragment is distinct many people can work on the genome at one time.

23. disadvantages of clone-by-clone sequencing? Making clones and generating genome maps takes a long time. Clone-by-clone sequencing is generally more expensive than other sequencing methods. Some parts of the chromosomes, such as the centromeres, are difficult to clone. This is because they contain long repetitive sections which makes them difficult to cut and clone into BACs. As a result you cannot sequence using clone-by-clone sequencing methods.

24. Genome sequencing Each of these approaches has advantages and disadvantages. The clone-by-clone method is reliable but slow, and the mapping step can be especially time-consuming . By contrast, the whole-genome shotgun method is potentially very fast, but it can be extremely difficult to put together so many tiny pieces of sequence all at once. Both approaches have already been used to sequence whole genomes. The whole-genome shotgun method was used to sequence the genome of the bacterium  Haemophilus influenzae , while the genome of baker's yeast,  Saccharomyces cerevisiae , was sequenced with a clone-by-clone method. Sequencing the human genome was done using both approaches.

25. Shortgun method .DNA is broken up randomly into numerous small segments , which are sequenced using the chain termination method to obtain  reads . Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a continuous sequence. Shotgun sequencing was one of the precursor technologies that was responsible for enabling full genome sequencing.

26. For example, consider the following two rounds of shotgun reads: Strand Sequence Original AGCATGCTGCAGTCATGCTTAGGCTA First shotgun sequence AGCATGCTGCAGTCATGCT------- -------------------TAGGCTA Second shotgun sequence AGCATG-------------------- ------CTGCAGTCATGCTTAGGCTA Reconstruction AGCATGCTGCAGTCATGCTTAGGCTA

27. Genome mapping A genome map helps scientists navigate around the genome Genome mapping is used to identify and record the location of genes and the distances between genes on a chromosome. OR Gene mapping  describes the methods used to identify the locus of a  gene  and the distances between genes. Genome mapping provided a critical starting point for the Human Genome Project.

28. Different types of genome mapping There are two general types of genome mapping called genetic mapping physical mapping.

29. Genetic mapping Genetic mapping looks at how genetic information is shuffled between chromosomes or between different regions in the same chromosome during meiosis (a type of cell division). A process called recombination or ‘crossing over.

30. Physical mapping Physical mapping looks at the physical distance between known DNA sequences (including genes) by working out the number of base pairs (A-T, C-G) between them.

31. Genome variation Genome variations are differences in the sequence of DNA from one person to the next. In fact, people are unique in large part because their genomes are unique.

32. Why is every human genome different? Every human genome is different because of mutations—"mistakes" that occur occasionally in a DNA sequence. When a cell divides in two, it makes a copy of its genome, then parcels out one copy to each of the two new cells. Theoretically, the entire genome sequence is copied exactly, but in practice a wrong base is incorporated into the DNA sequence every once in a while, or a base or two might be left out or added. . Causes of differences between individuals include independent assortment the exchange of genes (crossing over and recombination) during reproduction (through meiosis and various mutational events.

33. Where are genome variations found? Variations are found all throughout the genome, on every one of the 46 human chromosomes The majority of variations are found outside of genes, in the "extra" or "junk" DNA that does not affect a person's characteristics. Mutations in these parts of the genome are never harmful, so variations can accumulate without causing any problems. Genes, by contrast, tend to be stable because mutations that occur in genes are often harmful to an individual, and thus less likely to be passed on.

34. What kinds of genome variations are there? Genome variations include mutations and polymorphisms  is a DNA variation in which each possible sequence is present in at least 1 percent of people

35. If one of the possible sequences is present in less than 1 percent of people (99.9 percent of people have a G and 0.1 percent have a C), then the variation is called a mutation. the term mutation is often used to refer to a harmful genome variation that is associated with a specific human disease, while the word polymorphism implies a variation that is neither harmful nor beneficial

36. About 90 percent of human genome variation comes in the form of single nucleotide polymorphisms, or SNPs (pronounced "snips"). As their name implies, these are variations that involve just one nucleotide, or base. Any one of the four DNA bases may be substituted for any other—an A instead of a T, a T instead of a C, a G instead of an A, and so on.

37. Human genome project The Human Genome Project (HGP) was the international, collaborative research program whose goal was the complete mapping and understanding of all the genes of human beings. All our genes together are known as our "genome.“ The HGP has revealed that there are probably about 20,500 human genes. James Watson was appointed to lead the NIH component, which was dubbed the Office of Human Genome Research.   

38. HGP researchers deciphered the human genome in three major ways: determining the order, or "sequence ," of all the bases in our genome's DNA; making maps that show the locations of genes for major sections of all our chromosomes; and producing what are called linkage maps, through which inherited traits (such as those for genetic disease) can be tracked over generations.

39. Types of genomics Structural genomics:  Aims to determine the structure of every protein encoded by the genome. Functional genomics:  Aims to collect and use data from sequencing for describing gene and protein functions.

40. Types of genomics Comparative genomics:  Aims to compare genomic features between different species. Mutation genomics:  Studies the genome in terms of mutations that occur in a person's DNA or genome.

41. Types of genomics Epigenomics  is the study of the complete set of epigenetic modifications on the genetic material of a cell, known as the  epigenome Epigenome  is the complete description of all the chemical modifications to DNA and histone proteins that regulate the expression of genes within the genome.

42. Types of genomics Metagenomics is the study of metagenomes, genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, eco genomics or community genomics. OR  the collective genome of microorganisms from an environmental sample—to provide information on the microbial diversity and ecology of a specific environment. 

43. Scope of genomics The field of genomics can be subdivided into a number of areas. For instance, comparative genomics involves comparing the genomes of different organisms. Comparative genomics can be used to define important structural sequences that are identical in many genomes and to detect evolutionary changes across genomes. Structural genomics involves the physical nature of genomes and includes the sequencing and mapping of genomes. Functional genomics involves studying the expression and function of the genome. Genomics can also involve the investigation of interactions between genes and between genes and the environment.

44. Applications of genomics. What genomics is used for There are many applications for human genetics in medicine, biotechnology, anthropology and other social sciences. Application of genomics: Gene therapy to cure genetics diseases

45. Genetic diseases A genetic disorder is a disease caused in whole or in part by a change in the DNA sequence away from the normal sequence. Genetic disorders can be caused by a mutation in one gene (monogenic disorder), by mutations in multiple genes (multifactorial inheritance disorder), by a combination of gene mutations and environmental factors, or by damage to chromosomes (changes in the number or structure of entire chromosomes, the structures that carry genes).

46. types of genetic disorders There are a number of different types of genetic disorders (inherited), including the following: Single gene inheritance sickle cell anemia Multifactorial inheritance diabetes Chromosome abnormalities Klinefelter syndrome Mitochondrial inheritance dementia

47. Gene therapy Gene therapy is an experimental technique that uses genes to treat or prevent disease. In the future, this technique may allow doctors to treat a disorder by inserting a gene into a patient’s cells instead of using drugs or surgery. Researchers are testing several approaches to gene therapy, including: Replacing a mutated gene that causes disease with a healthy copy of the gene. Inactivating, or “knocking out,” a mutated gene that is functioning improperly. Introducing a new gene into the body to help fight a disease.

48. Thanks