LETA_African Biotechnology congress_2.pptx

Leta Tulu presentation at the First African biotechnology congress

1. Building Drought Resilience in Tropical Maize: Success in Genetic Engineering and Promises of Genome Edition Leta Tulu Bedada Ethiopian Institute of Agricultural Research (EIAR) National Agricultural Biotechnology Research Centre (NABRC) Email: [email protected]

2. Global production of maize in comparison with other commodities (million tones)

3. Dynamics of key maize indicators 1961–2019: maize area (M ha), production (M t), yield (tons/ha) and export share (export/total production , %). Source : Erenstein et al., 2022

4. Global share of maize area (left) and production (right) by region Source : Erenstein et al., 2022

5. Area and production of maize in Africa Source: FAOSTAT 2022

6. Position of maize production in Africa in relation to other crops Source: FAOSTAT 2022

7. Trends in maize area and production in Africa Source : FAOSTAT 2022

8. Maize production in Ethiopia in relation to other commodities (Million tones ) Source : FAOSTAT 2022

9. Maize production trends in Ethiopia from 1995-2020 1980 BH140 SG2000 led extension 1990 BH660 Pioneer seed Several Private seed companies

10. Population growth and maize demand by 2050

11. Drought : a major limitation to crop production worldwide ( Lobell et al ., 2011). Climate change and global warming are accelerating its effect. Climate model predictions: indicate severity of drought and famines in todays drought prone areas (IPCC, 2022). Maize is more sensitive to drought than other crops. Most severe reductions in yield occurs when drought comes at pre- anthesis and grain-filling periods.  Drought damage : Grain yield losses of more than 70 %, complete crop failures Studies reported average annual production losses accounted for 22.3 billion USD for maize, much higher than losses in any other crops.

12. Increasing frequency, intensity, and duration of drought expected to continue with the current situation of climate change causing crop failures and hunger crisis.

13. Source : Erenstein et al ., 2022, originally adapted from Bellon et al. (2005) with updated climate data Global map of rainfed (sub-)tropical maize mega-environments .

14. Ethiopia: 40% (1 000 000 ha) of the total maize area is affected by drought ( Nigussei et al ., 2002 ). Contributes only 20% of the national maize production. 80 % comes from 60%(1.5 million ha) the high rainfall areas (Abate et al. 2015). Potential suitable distribution areas of maize under both current and future conditions . Source: Tan et al., 2016

15. Multiple stress factors operate under the real field condition

16. A breeding strategy needs to be developed to enhance resilience of maize to extreme changes in environment such as drought . A reality, conventional breeding played significant role in developing improved varieties which have contributed to better food production. Limited genetic diversity in the maize gene pool (Hardy, 2010) for tolerance to stresses such as drought. Maize genome lacks important genes and also has some genomic problems that must be corrected. We cannot totally depend on conventional breeding to feed the ever-increasing population, as it cannot yield faster solutions to the problems ahead. Modern and new breeding methods including genetic transformation and genome editing need to be applied in their full potential in complementing conventional breeding .

17. Damaging effect of drought Interfering with different physiological aspects of the plant Interferes with uptake of nutrients like Nitrogen Accentuates the effects of high temperature and high solar intensity causing leaves to turn yellow because of photoinhibition and chlorophyll bleaching (Smart et al ., 1991). Plants produce large quantities of reactive oxygen species (ROS) as a response to drought stresses.

18. Contribute to the decline in cytokinin level interfering with its biosynthesis in the roots which triggers leaf senescence ( van Staden et al. , 1988). Cytokinin biosynthesis, transport, and homeostasis in plants Source: Ma´rquez-Lo´pez et al., 2016

19. 05/03/2025 19 Drought induces pre-mature leaf senescence Maize launches leaf senescence as an adaptation strategy by reducing canopy size. The earliest significant change: Breakdown of the chloroplast Carbon assimilation is replaced by catabolism of chlorophyll and macromolecules It is undesirable in food crops

20. 05/03/2025 20 Leaf Senescence is genetically regulated SDGs : Senescence down regulated genes, Include genes involved in photosynthesis, SAGs : Senescence activated genes, genes encoding RNases , proteinases, Lipases are up regulated ( Gan and Amasino , 1997 ) Molecular basis of leaf senescence

21. 05/03/2025 21 Depends on physiology of phytohormone : Cytokinin Exogenous application of cytokinin retards senescence Cytokinin promotes cell division, leaf expansion, accumulation of chlorophyll Directly or indirectly inhibits transcription of SAGs that code for RNases , proteinases , lipases (Buchanan-Wollaston et al ., 1997). Approaches to delay leaf senescence

22. 05/03/2025 22 Discovery of ipt gene in Agrobacterium ( Akiyoshi et al. 1984) Tumer inducing plasmid of Agrobacterium bearing gene for cytokinin biosynthesis on the T-DNA. Molecular-Genetic approach to delay drought induced leaf senescence in maize To enable it defend itself by enhancing endogenous cytokinin production through genetic engineering using ipt gene

23. PATHWAY OF CYTOKININ BIOSYNTHESIS

24. IPT gene delays leaf senescence Over expression of the ipt gene in plants led to elevated foliar cytokinin concentrations and delayed leaf senescence ( Rivero et al ., 2007; Peleg et al ., 2011). This created interest to investigate if ipt gene can be useful in enhancing drought tolerance in farmers preferred and locally adapted tropical maize genotypes .

25. Plants produce large quantities of reactive oxygen species (ROS) as a response to drought stresses. Protection from harmful ROS by undergoing a variety of biochemical and physiological responses. One of such responses is the generation of antioxidant enzyme like peroxiredoxin2, which scavenges ROS and convert them to harmless molecules, thereby protecting plant cell membranes and DNA from damage.

26. Xerophyta viscosa , a resurrection plant native to South Africa Can be dehydrated to an air dry state but can be rehydrated upon rewatering , mechanism controlled by a number of genes

27. The XvPrx2 gene is stress-inducible in response to abiotic stresses and it has been revealed that XvPrx2 homologues exist within the X. viscosa proteome ( Govender et al., 2016). In vitro DNA protection assay showed that, in the presence of XvPrx2 DNA protection occurred . In vitro assays have also revealed maximum activity of the XvPrx2 with DTT(DL- Dithiothreitol ) as electron donor and H 2 O 2 as substrate ( Govender et al., 2016), implying that the gene is responsible for managing the ROS generated by plants under stress.

28. Genome edition to delay drought induced leaf senescence Comparative transcriptome and physiological analyses of key maize drought responsive genes indicated that the cysteine protease 1 gene is up regulated in maize during drought stresses ( Zenda et al ., 2019). Involved in degrading proteins Genome edition of this gene was reported to enhance drought tolerance by delaying leaf senescence (Wang et al ., 2022a & b). This presentation reveals to you success of developing drought tolerant maize through genetic engineering in Africa and highlights strategies in developing drought resilient and foreign DNA free maize through genome editing.

29. A grobacterium- mediated transformation of CML216 and CML144 maize inbred lines Molecular cloning and selection of selectable marker Limitations to Genetic Engineering : The presence of antibiotic resistance marker genes may complicate future commercialization Selectable markers selected for safety to the environment and consumers. We, sub-cloned the expression cassettes to the binary vector, pNOV2819,

30. 05/03/2025 30 Sub-cloning ipt and XvPrx2 gene gene in to P NOV 2819

31. PSARK RB IPT NosT CMPS PMI NosT LB Linear map of the expression cassettes (TDNAs) XvPsap1 XvPrx2 osTN CMPS PMI NosT LB RB

32. 05/03/2025 32 Mannose based selection system was used to select for transformed cells Biochemical reaction catalyzed by phosphomannose isomerase coded by the manA gene

33. 05/03/2025 33 A-G: Transformation and regeneration profile of transgenic tropical maize using Agrobacterium C : Selection D : Regeneration A : Cocultivation B : Resting E : Acclimatization F : Putative in peatmoss G: P SARK ::IPTCML216

34. 05/03/2025 34 Drought assay: Optimization experiment A Transgenic Wild Type Wild Type

35. 05/03/2025 35 Four months old t ransgenic and wild type plants growing in the glass house 0.5kb M +Cr RT- P 1 P 2 P 3 P 4 WT 0. 5kb RT-PCR analyses of ipt gene expression in four drought stressed PSARK::IPT CML216 transgenic plants(P1-P4). The same cDNA amplified with Actin primers (lower panel) used as internal control Analysis of gene expression Wild Type Transgenic

36. Six week old transgenic and wild type CML144 maize plants under different stages of drought stress. 1 week stress 3 weeks stress 2 weeks stress 6 hours after rewatering 4 days after rewatering

37. 05/03/2025 37 L eaf relative water content measured in 8 weeks old transgenic and wild type plants during drought stress assay in the glasshouse (CML216) sult a a a a a b b b b b Means labelled with different letters are significantly different according to LSD test at 5% probability level

38. Leaf RWC as affected by drought stress and recovery after re-watering in transgenic maize and wild type CML144 maize plants.

39. 05/03/2025 39 A B C D Chlorophyll level measured during watering, drought and rewatering experiments in the glass house, A : Total chlorophyll, B : Chlorophyll a, C : Chlorophyll b, D : Total carotenoids . Values are mean±SE (n=12) a a b b a a a b b b a a b b a b a b

40. Genome edition approach to delay leaf senescence Discovery of a novel senescence activated gene ( ZmSAG39 ) in maize by team of researchers (Wang et al . (2022a) . ZmSAG39 overexpression lines showed precocious senescence phenotype after growing under continuous light for 40 days. Expression patterns of ZmSAG39 in maize leaves under dark and drought stress conditions.

41. The senescence process of detached leaves of overexpressing lines was accelerated under dark treatment, while drought treatment promoted ROS accumulation. ZmSAG39 Overexpression lines displayed precocious leaf senescence under dark conditions.

42. ZmSAG39 gene cDNA from maize line M8186 was sub-cloned into pCAMBIA3301 vector under the control of the CaMV35S promoter . sgRNA sequence of CCAGGTATCAAGGCGAACGCGG was designed to target specific sequence of the ZmSAG39 gene to introduce mutation in the coding region through CRISPR/Cas9 gene editing approach . Seeds of WT and transgenic lines germinated different solutions of PEG6000 Leaf senescence phenotype in WT and transgenic lines after drought treatment

43. ZmSAG39 overexpression in maize accelerated the senescence of maize in drought treatments knockout of ZmSAG39 gene in maize enhanced the resistance of maize to drought stresses and reduced the degree of senescence of maize leaves. Under drought stress the knockout lines had a higher seed germination rate, seedling survival rate and chlorophyll content, and lower reactive oxygen species (ROS) level and malondialdehyde (MDA) content T he study laid theoretical foundation for developing drought tolerant maize by mutating coding sequences of ZmSAG39 gene families through gene editing. Our future research aims at building on the experiences of Wang et al (2022b) in developing drought tolerant tropical maize for Africa.

44. Strategies for applying Wang et. al. 2022 for developing drought tolerant tropical maize Online survey revealed four senescence activated genes (SAG) in maize. Multisequence alignment indicated similarity of the three genes indicating possibility of mutating them with a single sgRNA on a binary vector exon2 regions and can be targeted with common sgRNA .

45. Sequence alignment of the three SAGs (similarity in exone2 regions)

46. Gene editing modality CRISPR/Cas9 gene editing modality can be used in developing maize genotypes ( edits ) with improved drought tolerance (delayed leaf senescence). a single sgRNA , targeting exon2 in the conserved regions of the three ZmSAG genes) designed using online software CRISPER-P 2.0 (Lei et al., 2014) and integrated into pMDC32 binary vector (Fig. 1).

47. Maize inbred line for genome editing Genome editing requires a well established regeneration system and tissue culture responsive genotypes Previous studies identified CML216 as a tissue culture responsive and Agrbacterium friendly tropical maize inbred line. We have also identified other lines from the National Maize Breeding Program of Ethiopia Confirmation required to ensure that the inbred line has the target genes Basically needed to design the sgRNAs . Target genes amplified and PCR products sequenced The sequenced products will be aligned with sequences of the specific genes from the database to detect any allelic variation

48. Agrobacterium mediated maize transformation Follow the procedure established by Agrobacterium ( Bedada et al ., 2016). Immature embryos make the best explants for transformation. .

49. Molecular detection of mutant lines T and T 1 and T 2 generation, genomic DNA will be extracted and PCR will be carried out using primers targeting different segments of the T-DNA, such as the Cas9, OsU3p, OsU3t and Ubi promoter. To detect mutation in the target genes, fragments flanking the target sites will be amplified using PCR and the PCR products will be directly sequenced. Molecular analyses such as PCR, sequencing and sequence alignment of the wild type and mutant lines and qRT -PCR will be followed to confirm for mutation. Mutant plants advanced to next generation by controlled hand self-pollination until plants are homozygous for the trait. This will also help to confirm stability (heritability) of the mutant trait.

50. Generation of transgene free drought tolerant maize plants Mutants plants will be crossed with the wild type CML216 plants and the F 1 plants will be selfed to generate F 2 plants. These F 2 plants will be PCR tested with primers targeting different regions of the T-DNA. Absence of PCR amplification in the mutant lines will be an indication of transgene free product .

51. Phenotyping of the transgene free lines for important agronomic traits The CRISPR/Cas9 gene editing system is more precise and specific to the target genes. Plant products developed via the system are not expected to show morphological variations from the wild type plants except in the edited trait. To ascertain this homozygous and transgene free plants will be grown with the wild type plants in the field and evaluated for all important agronomic / morphological traits.

52. Evaluation of the transgene free mutant plants for drought tolerance Transgene free mutant lines evaluated for expression of the trait (delayed leaf senescence under drought/moisture deficit condition) along with the wild type line in the glasshouse Possibility of using PEG based laboratory procedure to impose stress

53. Using mutant lines in breeding programs Mutant lines can be used in breeding programs: transferring the delayed senescence trait to elite commercial inbred parents of hybrid varieties. For this a backcross breeding method will be applied using the mutant lines as a donor of the edited genes. Parental lines of commercial hybrids can be targeted; All the three parental lines of the respective hybrids should be converted for a knockout trait which is recessively inherited (Lopez et al., 2023).

54. ACKNOWLEDGMENT/GALATA/ ምስጋና Kenyatta University University of Cape town UC Davis ASARECA CIMMYT EIAR African Plant Breeding Academy