Transcription and Translation _ Biology

Transcription and Translation, mRNA, DNA,

1. Transcription and Translation

2. 1. Important Features a. DNA contains genetic template" for proteins. b. DNA is found in the nucleus c. Protein synthesis occurs in the cytoplasm - ribosome. d. "Genetic information" must be transferred to the cytoplasm where proteins are synthesized.

3. 2. Processes of Protein Synthesis a. Transcription - genetic template for a protein is copied and carried out to the cytoplasm b. Translation - template serves as a series of codes for the amino acid sequence of the protein

4. Cells Use RNA to Make Protein The RNA Players – mRNA, rRNA, tRNA During polypeptide synthesis, ribosomal RNA ( rRNA ) is the site of polypeptide assembly. Transfer RNA ( tRNA) transports and positions amino acids. Messenger RNA ( mRNA ) directs which amino acids are assembled into polypeptides. Central Dogma DNA 🡪 RNA🡪 Protein

5. Central Dogma of Gene Expression

6. Gene Expression Transcription – in the nucleus (if you have one) DNA sequence is transcribed into RNA sequence initiated when RNA polymerase binds to promoter binding site moves along DNA strand and adds corresponding complementary RNA nucleotide disengages at stop signal

7. 3. Steps of Transcription a. DNA unwinds, Helicase breaks H bonds b. One side of DNA "codes for a protein" c. Genetic code of DNA is a triplet code of 3 nucleotides or bases d. Each triplet is specific for the coding of a single amino acid e. Sequence of triplet codes on DNA will specify the amino acid sequence on the protein f. Major step is the synthesis of the coded " messenger" molecule – mRNA g. mRNA is "transcribed" from DNA by complementary base pairing (mRNA has no thymine, which is replaced by uracil) h. mRNA passes out to cytoplasm to the ribosome

8. Genetic Code Genetic code consists of a series of information blocks called codons . reading frame ( triplet ) each codes for one amino acid genetic code is nearly universal

9. The Genetic Code 1. A triplet code comprised of three nucleotide bases in a sequence. 2. How many triplet codes? 20 common amino acids in a protein 4 diff. bases on DNA A,T,C, & G | | | | 4 diff. bases on RNA U,A,G, & C

10. Why Triplet Code The logic is that the nucleotide code must be able to specify the placement of 20 amino acids. Since there are only four nucleotides, a code of single nucleotides would only represent four amino acids, such that A, C, G and U could be translated to encode amino acids. A doublet code could code for 16 amino acids (4 x 4). A triplet code could make a genetic code for 64 different combinations (4 X 4 X 4) genetic code and provide plenty of information in the DNA molecule to specify the placement of all 20 amino acids.

11. The 64 triplet codes 60 code for amino acids 4 act as "stop" and "start codes Degenerate Code- more than one triplet code for some amino acids e.g., All code for the amino acid glycine GGG GGU GGC GGA

12. Transcription RNA polymerase only one of two DNA strands ( template ) is transcribed non-transcribed strand is termed coding strand - same as RNA (except T’s are U’s) In both bacteria and eukaryotes, the polymerase adds ribonucleotides to the growing 3’ end of an RNA chain. synthesis proceeds in 5’🡪3’ direction

13. Transcription Promoter Transcription starts at RNA polymerase binding sites called promoters on DNA template strand. Initiation Other eukaryotic factors bind, assembling a transcription complex. RNA polymerase begins to unwind DNA helix , as Helicase breaks the H bonds.

14. Transcription Elongation Transcription bubble moves down DNA at constant rate leaving growing RNA strands protruding from the bubble. Termination Stop sequences at the end of the gene cause phosphodiester bond formation to cease, transcription bubble to dissociate, and RNA polymerase to release DNA.

15. Transcription Eukaryotic transcription differs from prokaryotic transcription: three RNA polymerase enzymes initiation complex forms at promoter RNAs are modified after transcription

16. Spliced Gene Transcripts DNA sequence specifying a protein is broken into segments ( exons ) scattered among longer noncoding segments ( introns ). Initially, primary RNA transcript is produced for the entire gene. Small nuclear ribonuclearproteins ( snRNPs ) associate with proteins to form spliceosomes . Excise introns and splice exons to form mature mRNA.

17. RNA Splicing During RNA processing, intron sequences are cut out of primary transcript before it is used in polypeptide synthesis. remaining exon sequences are spliced together to form final processed mRNA

18. Transcription Bubble

19. Eukaryotic Genes are Fragmented

20. Summary

21. Transcription video

22. mRNA DNA G U A C

23. Replication vs Transcription

24. Now TRANSLATION!!!!

25. 4. Translation overview a. mRNA attaches to the ribosome b. tRNA's attach to free amino acids in the cytoplasmic "pool" of amino acids c. tRNA carries its specific amino acid to the ribosome

26. Translation overview (cont.) d. tRNA "delivers" its amino acid based on complementary pairing of a triplet code (anticodon) with the triplet code (codon) of the mRNA . e. Enzyme "hooks" the amino acid to the last one in the chain forming a peptide bond. f. Protein chain continues to grow as each tRNA brings in its amino acid and adds it to the chain. - This is translation !!

27. Gene Expression Translation – in the cytoplasm at ribosome nucleotide sequence of mRNA transcript is translated into amino acid sequence in the polypeptide rRNA recognizes and binds to start sequence moves three nucleotides at a time disengages at stop signal Gene expression - collective of transcription and translation

28. Translation Begins when initial portion of mRNA molecule binds to rRNA in a ribosome tRNA molecule with complimentary anticodon binds to exposed codon on mRNA some tRNA molecules recognize more than one codon

29. Translation Start and stop signals start signal coded by AUG codon stop signal coded by one of three nonsense codons: UAA - UAG - UGA Initiation Polypeptide synthesis begins with the formation of an initiation complex. initiation factors

30. Translation Translocation ribosome moves nucleotides along mRNA molecule

31. Translation Termination Nonsense codons are recognized by release factors that release the newly made polypeptide from the ribosome.

32. aminoacyl tRNA synthetase

33. Peptidyl Transferase

34. ACTIVITY

35. ACTIVITY AUGCCCGGAUAUGCGAUGAUGAGUACCUAGCC AUG-CCC-GGA-UAU-GCG-AUG-AUG-AGU-ACC-UAG UACGGGCCUAUACGCUACUACUCAUGGAUCGG MET-PRO-GLY-TYR-AL-MET-MET-SER-THR-STOP

36. Differences Between Prokaryotic and Eukaryotic Gene Expression Eukaryotic mRNA molecules have introns cut out and exons joined together before translation. Eukaryotic ribosomes are larger than prokaryotic ribosomes.

37. Replication, Transcription and Translation

38. Animation