BTG 225 - Gene structure- function- variation and control -2023-2024.pptx.pdf

Gene structure- function- variation and control

1. BTG 225: MOLECULAR CELL
BIOLOGY (2 UNITS)

2. Gene structure, function, variation
and control

3. INTRODUCTION
The FOUR Classes of Large Biomolecules
●All living things are made up of four classes of large
biological molecules:
Carbohydrates
Lipids
Nucleic Acids
Protein

●Macromolecules are large molecules composed of
thousands of covalently bonded atoms

●Their molecular structure and function are inseparable.

4. INTRODUCTION contd…
●Nucleic acids are molecules that store information for cellular
growth and reproduction.

●Nucleic acids store, transmit, and help express hereditary
information.

●The amino acid sequence of a polypeptide is programmed by a
unit of inheritance called a gene.

●Genes are made of DNA, a nucleic acid made of monomers
called nucleotides.

5. ●There are two types of nucleic acids:
Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA)

●The DNA provides directions for its own replication, while the
DNA directs synthesis of messenger RNA (mRNA); and through
mRNA, controls protein synthesis.

●The DNA & RNA are polymers consisting of long chains of
monomers called nucleotides.

●And each nucleotide consists of a nitrogenous base, a
pentose sugar, and phosphate groups.

6. 5′C
Phosphate
group
Sugar-phosphate
backbone
5′ end
3′C
5′C
3′C
3′ end
(a) Polynucleotide, or nucleic acid
(b) Nucleotide
Sugar
(pentose)
Nucleoside
Nitrogenou
s
base
5′C
3′C
1′C

7. Nitrogenous Bases
●The nitrogenous bases in
nucleotides consist of two
general types:

-Pyrimidines: Cytosine (C),
Thymine (T) and Uracil (U).
They have a single
six-membered ring.

-Purines: Adenine (A) and
Guanine (G). They have a
six-membered ring fused to
a five-membered ring.

8. Pentose Sugars
●There are two related pentose sugars:
-RNA contains ribose
-DNA contains deoxyribose

●The sugars have their carbon atoms numbered with primes to
distinguish them from the one in nitrogen bases

9. Nucleosides and Nucleotides
●A nucleoside consists of a nitrogen base linked by a glycosidic
bond to C1’ of a ribose or deoxyribose

●Nucleosides are named by changing the nitrogenous base
ending to -osine for purines and –idine for pyrimidines

●A nucleotide is a nucleoside that forms a phosphate ester with
the C5’ OH group of ribose or deoxyribose

●Nucleotides are named using the name of the nucleoside
followed by 5’-monophosphate

11. Names of Nucleosides and Nucleotides

12. AMP, ADP and ATP
●Additional phosphate groups can be added to the nucleoside
5’-monophosphates to form diphosphates and triphosphates.
●ATP is the major energy source for cellular activity.

13. Primary Structure of Nucleic Acids
●The primary structure of a nucleic acid is the nucleotide sequence.
●The nucleotides in nucleic acids are joined by phosphodiester bonds.
●The 3’-OH group of the sugar in one nucleotide forms an ester bond
to the phosphate group on the 5’-carbon of the sugar of the next
nucleotide

14. ●Adjacent nucleotides are joined by
covalent bonds that form between the
—OH group on the 3′ carbon of one
nucleotide and the phosphate on the
5′ carbon on the next

●These links create a backbone of
sugar-phosphate units with
nitrogenous bases as appendages

●The sequence of bases along a DNA
or mRNA polymer is unique for each
gene

15. Reading Primary Structure
●A nucleic acid polymer has a free
5’-phosphate group at one end and
a free 3’-OH group at the other end

●The sequence is read from the free
5’-end using the letters of the bases

⚫This example reads
●5’—A—C—G—T—3’

16. Example of RNA Primary Structure
●In RNA, A, C, G,
and U are linked by
3’-5’ ester bonds
between ribose
and phosphate

17. Example of DNA Primary Structure
●In DNA, A, C,
G, and T are
linked by 3’-5’
ester bonds
between
deoxyribose
and phosphate

18. DNA and RNA Compared

19. Secondary Structure of RNA Molecule
●RNA molecules usually come as single strands but left in their
environment they fold themselves in their tertiary structure

●This is also made possible through the hydrogen bonding
mechanism.

●Helices, also known as stems, are formed intra-molecularly .

20. Secondary Structure:DNA Double Helix
●In DNA there are two strands of polynucleotides that wind
together in a double helix; spiraling around an imaginary axis:
-the strands run in opposite directions of 5′→ 3′ (antiparallel)
-the bases are arranged in step-like pairs
-the base pairs are held together by hydrogen bonding

●The pairing of the bases from the two strands is very specific

●The complimentary base pairs are A-T and G-C
-two hydrogen bonds form between A and T
-three hydrogen bonds form between G and C

21. ●Two complementary nucleotide
strands are held together with
hydrogen bonds between
the Waston-Crick pairs A-T and
C-G.

●Each pair consists of a purine
and a pyrimidine, so they are the
same width, keeping the two
strands at equal distances from
each other

22. Base Pairing in the DNA Double Helix

23. Storage of DNA
●In eukaryotic cells (animals, plants, fungi), DNA is stored in the
nucleus, which is separated from the rest of the cell by a
semi-permeable membrane

●The DNA is only organized into chromosomes during cell
replication

●Between replications, the DNA is stored in a compact ball called
chromatin, and is wrapped around proteins called histones to
form nucleosomes

24. Functions of DNA (Deoxyribonucleic Acid)
●DNA is a permanent storage place for genetic information.

●DNA controls the synthesis of RNA (ribonucleic acid).

●The sequence of nitrogenous bases in DNA determines the
protein development in new cells.

●The function of the double helix formation of DNA is to ensure
that no disorders occur.

This is because the second identical strand of DNA that
runs anti-parallel to the first is a backup in case of lost or
destroyed genetic information.

25. Functions of RNA (Ribonucleic Acid)
●RNA is synthesized by DNA for the transportation of genetic
information to the protein building apparatus in the cell.

●RNA also directs the synthesis of new proteins using the
genetic information it has transported.

●mRNA (messenger ribonucleic acid) is used to transfer genetic
information through plasma membranes.

26. DNA Replication
●Nucleic acids (specifically DNA) carry out a vital role in the
human body.

●In particular, nucleic acids play an essential role in both mitosis
and meiosis.

●In mitosis, the chromosomes (or genetic information) contained
inside the nucleus of the parent cell is duplicated.

●The two resulting daughter cells have identical genetic
information to the parent cell.

27. ●This is possible only through nucleic acid’s remarkable ability to
create identical copies of itself through replication.

●The DNA must be replicated so that eachdaughter cell has a
copy. It is the only molecule known to have this ability.

●Mitosis is essential to life because it replaces damaged or dead
cells, repairs tissues, and allows the body to grow (in mass and
size).

28. ●DNA replication involves several processes:
–first, the DNA must be unwound through the help of DNA gyrase and
helicase enzymes, separating the two strands
–the single strands then act as templates for synthesis of the new
strands (which are complimentary in sequence)
–bases are added one at a time until two new DNA strands that exactly
duplicate the original DNA are produced by the DNA polymerase.

●The process is called semi-conservative replication because
one strand of each daughter DNA comes from the parent DNA
and one strand is new.

●The energy for the synthesis comes from hydrolysis of
phosphate groups as the phosphodiester bonds form between
the bases.

29. Semi-Conservative DNA Replication

30. Direction of Replication

The enzyme helicase unwinds several sections of parent DNA

At each open DNA section, called a replication fork, DNA
polymerase catalyzes the formation of 5’- 3’ester bonds of the
leading strand

The lagging strand, which grows in the 3’-5’ direction, is
synthesized in short sections called Okazaki fragments

The Okazaki fragments are joined by DNA ligase to give a
single 3’-5’ DNA strand

32. Transcription
●Cells are governed by a cellular chain of command, which
ensure that information is transferred from DNA to RNA to
protein.

●This is the central dogma of molecular biology, that is:
DNA → RNA → Protein

33. Transcription contd…
●This is the synthesis of RNA under the direction of DNA

●RNA synthesis Is catalyzed by RNA polymerase, which pries
the DNA strands apart and hooks together the RNA
nucleotides.

●The process follows the same base-pairing rules as DNA,
except that in RNA, uracil substitutes for thymine

34. ●Differences between the RNA and DNA
RNA is single stranded, not double stranded like DNA.
RNA is short, only 1 gene long, where DNA is very long and
contains many genes (polygene RNA).
RNA uses the sugar ribose instead of deoxyribose in DNA.
RNA uses the base uracil (U) instead of thymine (T) in DNA.

▪What RNA strand will be made from the following DNA
sequence?
TACGCATGACTAGCAAGTCTAACT
AUGCGUACUGAUCGUUCAGAUUGA

35. RNA types and functions

37. Write out the transcript of the sequences below:
1.
5´-CATGCCTGGGCAATAG-3´
3´-GTACGGACCCGTTATC-5´
2.
5´-TACGCATGACTAGCAAGTCTAACT-3´
3´-ATGCGTACTGATCGTTCAGATTGA-5´

38. Processing of the RNA transcripts
●The newly made RNA, also known as the primary transcript
(NB: the product of transcription is known as a transcript) is
further processed before it is functional.

●Both prokaryotes and eukaryotes process their ribosomal RNA
(rRNA) & transfer RNA (tRNA).

●The major difference in RNA processing, however, between
prokaryotes and eukaryotes, is in the processing of mRNAs.

●In bacterial cells, the mRNA is translated directly as it comes off
the DNA template.

39. ●In eukaryotic cells, RNA synthesis, which occurs in the nucleus, is
separated from the protein synthesis machinery, which is in the
cytoplasm.

●In addition, eukaryotic genes have introns, noncoding regions that
interrupt the gene.

●The mRNA copied from genes containing introns will also therefore
have noncoding regions that interrupt the information in the gene.

●These noncoding regions must be removed before the mRNA is sent
out of the nucleus to be used for protein synthesis.

●The process of removing the introns and rejoining the coding sections
(exons) of the mRNA is called splicing.

40. DNA
exon 1 intron exon 2 interon exon 3
pre-RNA (in nucleus)
exon 1 exon 2 exon 3
RNA (in cytoplasm)
transcription
intron
intron
RNA editing
Note that, Ribozymes are catalytic RNA molecules that function as
enzymes and can splice RNA. RNA Splicing can also be carried out
by spliceosomes.

41. ●Now that our mRNA molecule has been made, it’s time for its
message to be made into a protein sequence.

●How does the mRNA sequence is converted into an amino
acid sequence?

●Through Translation process