c. jejuni.pptx

Campylobacter (curved rod in Greek) may have been discovered in the late nineteenth century (1886) by Theodor Escherich from an infant who died of cholera and called the disease “cholera infantum”

In the last 30 years, Campylobacter has been recognized as a leading pathogen causing diseases in both animals and humans and considered a zoonotic pathogen

Campylobacters (formerly Vibrio fetus) were first associated with diseases of cattle and sheep at the beginning of 20th century

1. welcome

2. Campylobacter jejuni in Milk & Milk Product Soniya Ashok Ranveer P h. D ( Dairy Microbiology )

3. Campylobacter (curved rod in Greek) may have been discovered in the late nineteenth century (1886) by Theodor Escherich from an infant who died of cholera and called the disease “cholera infantum” In the last 30 years, Campylobacter has been recognized as a leading pathogen causing diseases in both animals and humans and considered a zoonotic pathogen Campylobacters (formerly Vibrio fetus ) were first associated with diseases of cattle and sheep at the beginning of 20 th century Introduction

4. Introduction Campylobacter enteritis, caused by C. jejuni and C. coli , is a relatively recent disease First recognized following several water and milk borne epidemics in the mid-1970s Epidemics involving C. jejuni have been reported from both developed and underdeveloped countries and it is also one of the causative agents of traveller's diarrhea

5. Taxonomy

6. Characteristic of Campylobacter jejuni

7. Characteristic Growth Growth at 25 °C − Growth at 35–37 °C + Growth at 42 °C + Nitrate reduction + Catalase test + Oxidase test + Growth on MacConkey agar + Motility (wet mount) + Glucose utilization − Hippurate hydrolysis + Resistance to nalidixic acid − Resistance to cephalothin + Biochemical Test Barret et al. 1988

8. Growth Characteristics Campylobacters cannot ferment or oxidize sugars Oxygensensitive microaerophiles , growing best in an atmosphere containing 5–10% carbon dioxide and 3–5% oxygen All Campylobacter species grow at 37.1°C; C. jejuni have optima at 42–45.1°C but cannot survive cooking or pasteurization temperatures (D 55 2.5–6.6 min) They do not grow below 30.1°C and survive poorly at room temperature Viability declines during chill or frozen storage, never persist under these conditions for prolonged periods Survival in milk and water at 41°C For growth pH range is 5.5 to 8.8 Optimum pH -6.5-7.5 Abeyta et al ., 1987

9. Pathogenicity and Virulence Motility, chemotaxis and the corkscrew morphology of the cells are all important factors in the virulence Enabling it to penetrate the viscous mucus which covers the epithelial surface of the gut Lipooligosaccharide (LOS) is highly variable and has a role in serum resistance, epithelial cell adherence and invasion. Flagellin is modified by O‑linked glycosylation and N‑linked‑glycosylation system modifies some periplasmic and outer‑membrane proteins . Dasti et al. 2010

10. Representative Bacterial Factors Involved in the Pathogenesis of Campylobacteriosis

11. C. jejuni circumvents the mucus layer and interacts with the intestinal epithelial cells causing interleukin (IL)‑8 C. jejuni binds to, and is internalized by, epithelial cells Induction of IL‑8 causes the recruitment of dendritic cells (DC), macrophages and neutrophils, Results in a massive pro‑inflammatory response and increases in the corresponding cytokines Immune responses in human due to invasion of C.jejuni

12. Mode of Transmission Sources Raw and undercooked poultry, unpasteurized milk, Contaminated water Incubation Period 2-5 days Duration of Illness 2-10 days Mangen et al ., 2010

13. Symptoms

14. Vulnerability Bacteremia is detected in <1% of patients with Campylobacter enteritis immunocompromised or among the very young(<1 year of age) or very old Guillain-Barré syndrome (GBS) - 1–2 persons per 100,000 population (USA) Post-infectious complication Fatality rate - 0.05 per 1000 infections

15. Method of Detection 1) Enrichment broth Bolton formula 2)Isolation procedure Abeyta -Hunt-Bark (AHB) Agar or modified campy blood-free ( mCCDA ) agars

16. 3)Identification Thick translucent white growth to spreading, film-like transparent growth 4) Confirmation Bubbles (a loopful of growth in a drop of 3% H 2 O 2 )indicate positive catalase test Oxidase reagent turns purple , oxidase-positive. Hippurate hydrolysis Test

17. Hunt et al ., 2001

18. Confirmation and Species Identification of Isolates Using (PCR) Type of PCR Toxin and its sequence Traditional and multiplex PCR Heat shock protein - hsp60 5’-CAAGTTGCTACAATCTCAGCCA-3’ Water samples; USA;  Park et al . (2011) Cytolethal distending toxin – cdt 5’-AGGACTTGAACCTACTTTTC-3’ Broiler carcasses, vegetable samples; Brazil;  Asakura et al . (2007) , qPCR and dPCR ATP binding protein - cje0832 5’-AGTGCCGATAAAGGCTCATCA-3’ 5’-ACTCGTCGAGCTTGAAGAATACG-3’ Poultry, fish, beef, pork, milk, vegetable samples; Spain;  Bonjoch et al. (2009) VS1 gene 5’‐GAATGAAATTTTAGAATGGGG‐3’ 5’‐GATATGTATGATTTTATCCTGC‐3’ Chicken, milk, water; China;  Yang et al. (2006) C. jejuni NCTC11168 genome sequence (1.6 megabases ) completed- in 2000 Toxin genes (encoded in chromosome)present in Campylobacter are cytolethal distending toxins (CDTs)

19. Prevalence of C.jejuni in Milk Cases References In bulk milk tank (BTM) was around 0.4 %to 12.3% :A summary of studies 1982-2000: Oliver et al . 2005 Italy- 12% in BTM Bianchini et al . 2014 Italy- 6.45% ( in line milk filters) Giacometti et al 2012 USA – 2% in BTM Jayarao et al . 2006 Sweden - 12% ( in line milk filters)

20. Outbreaks in Milk Cheese and Dairy Products 8.5% of all oubreaks caused by campylobacter

21. Outbreak caused by campylobacter by food category, 2010-2017

22. Outbreaks Worldwide An estimated 2.5 million cases per year in the United States Annually more than 60,000 reported cases in Germany, alone Campylobacter spp. are responsible for approximately 17% of hospitalizations Only 5% of estimated food-related deaths

23. Test outcomes out of 58 samples of paneer Bacteriological counts 3 x 10 2 to 9.7 x 10 10 CFU/mL Bacteriological count of 65% samples > 10 6 CFU/mL MBRT positive - 54 samples (93%) Phosphatsae enzyme positive 2samples (3.4%) C. Jejuni 17.2% of them Possible reason for gastro-intestinal illness of consumers Indian Scenario

24. Study period - During January 2008–December 2010 Campylobacter  spp. was ≈7%    C. jejuni was the predominant species (78%) Isolation rate was significantly higher (10.0%; for children <5 years For other age group (3.7%)

25. Kaakoush et al. 2015 Nadeeem et al. 2015

26. Scientific reports on risk factors for human infection indicate that C. jejuni can contaminate various foodstuffs, including raw milk and dairy products, and that raw milk has been responsible for major disease outbreaks In that study, 378 in-line milk filters were collected from 27 farms authorized for the production and sale of raw milk (14 filters for each farm) and evaluated qualitatively (presence or absence) by culturing. C. jejuni was detected in eight samples from three farms, indicating intrafarm variability during the survey period Risk output

27. For each pathogen considered, two dose output models were achieved: one for the best and the other for the worst storage milk chain scenarios Dose Campylobacter40C ~10˄ (C-[DRT(Camp 4°)X T(h)]-Boil) x Si Dose CampylobacterDT ~10˄ (C-DRT(Camp Δ TX T(h)]-Boil) x Si Pathogen dose per serving size

28. The most frequently used dose-response model for Campylobacter is the beta-Poisson based on the data of a volunteer study . According to the beta-Poisson model the probability of human infection can be defined by which expresses the probability of raw milk consumer infection provided that b .. a, where a and b are parameters of the beta-Poisson dose-response model. In the case of Campylobacter infection, the parameters of the beta-Poisson model estimated are a ~ 0.145 and b ~ 7.589. The infection status linked to consumption of raw milk (the presence or absence of infection) as simulated as Dose response P inf ~1{ð1zDose= bÞ {a

29. Data were collected in one province of the Emilia Romagna Region from all farms authorized to produce and sell raw cow’s milk These farms served 60 vending machines and together sold about 3,000 liters of raw milk daily The province was used as the epidemiologic unit because the direct sale of raw milk is allowed only for the local area, i.e., the province where the raw milk is produced and the neighboring provinces The province has a population of around 995,000 people with a surface area of around 370,000 ha Exposure assessment

30. Time-temp history of milk and growth model Concentration before consumption habits Milk filter survey (378 in line milk filter were collected from 27 farms, 14 filter for each farm) Best storage condition (4° throughout all phases) Doubling time Decimal reduction Time(DRT) Worst storage condition doubling time Decimal reduction Time(DRT) Milk production milk contamination status Concentration in milk in bulk tank Data of previous study, in which the handling of raw milk by farmer and by consumer was evaluated, temperature of storage in bulk tank milk, during temp from farm to vending machine Probability of illness from a single exposure to contaminated raw milk

31. Consumption habits (conservation time at to 5 days, boil only in 57% of cases) Serving size(up to 11 per portion) Number of pathogens per serving Concentration at time of consumption in the best case scenario Concentration at time of consumption in the worst case Data from a previous study consumer interview and amount of raw milk consumed Probability of illness from a single exposure Number of cases expected to each year 5.25 million portions per vear Probability of illness from a single exposure to contaminated raw milk

32. Risk Profiling of C.Jejuni in Raw milk Estimated C. jejuni levels in raw milk under the best and worst storage conditions and after boiling Giacometti et al., 2012

33. Prevention Prevent reckless use of antibiotics Pasteurization of milk PRPs like GMP – helps to maintain sanitation Proper CIP – to keep in line filters clean The Five keys are: Keep clean Separate raw and cooked Cook thoroughly Keep food at safe temperatures Use safe water and raw materials

34. Thank You