DNA fingerprinting

Define DNA fingerprint and DNA fingerprinting.
Explain some terms related to DNA fingerprinting.
Describe the method of collection and preservation of biological samples.
Describe the uses of DNA fingerprinting.
Describe the types of DNA fingerprinting.
Describe the steps of DNA fingerprinting.

1. DNA Fingerprinting Dr . Md. Mohiuddin Masum Bangabandhu Sheikh Mujib Medical University Dhaka , Bangladesh.

2. 3 2 1

3. Define DNA fingerprint and DNA fingerprinting Explain some terms related to DNA fingerprinting Describe the method of collection and preservation of biological samples Describe the uses of DNA fingerprinting Describe the types of DNA fingerprinting Describe the steps of DNA fingerprinting Objectives

4. A small set of DNA variation t hat is very likely to be different i n all unrelated individuals, t hereby being as unique to individuals a s are fingerprint DNA Fingerprint

5. A method used to identify an individual from a sample of DNA by looking at unique patterns in their DNA sequence DNA Fingerprinting www.yourgenome.org

6. Also known as, DNA Fingerprinting DNA profiling DNA testing DNA typing Genetic fingerprinting

7. The beginning

8. The beginning

9. The beginning

10. Reference sample https:// quizlet.com/chapter-2-the-crime-scene-definitions/ Terms related to DNA fingerprinting

11. Terms related to DNA fingerprinting P olymorphism http:// groups.molbiosci.northwestern.edu//DNA_polymorphism

12. Terms related to DNA fingerprinting DNA Polymorphism http:// groups.molbiosci.northwestern.edu//DNA_polymorphism Single nucleotide polymorphism ( SNP) Minisatellite or variable number of tandem repeat ( VNTR) Microsatellite or short tandem repeat (STR )

13. Terms related to DNA fingerprinting Junk DNA Proteomics & Genomics/Dr . Vikash Kumar Dubey 95%

14. Terms related to DNA fingerprinting Tandem repeat www.bio.miami.edu/dana/dox/vntr.html

15. Terms related to DNA fingerprinting Tandem repeat

16. Terms related to DNA fingerprinting Minisatellite or VNTR AGTTCGCGTGAAGTTCGCGTGAAGTTCGCGTGA https ://en.wikipedia.org/wiki/Variable_number_tandem_repeat

17. Terms related to DNA fingerprinting Microsatellite or STR ATGCCATGCCATGCCATGCCATGCC https ://en.wikipedia.org/wiki/Microsatellite

18. Terms related to DNA fingerprinting Restriction endonuclease Escheria coli EcoRI 5’ GAATTC 3’ 3’ CTTAAG 5’ 5’ G AATTC 3’ 3’ CTTAA G 5’ https:// en.wikipedia.org/wiki/Restriction_enzyme

19. Blood Saliva Semen Tissue from personal item From stored sample Hair follicle Sources of DNA evidence

20. Sources of DNA evidence

21. Collection & preservation of biological samples

22. Forensic science Paternity and maternity determination Personal identification Use of DNA fingerprinting

23. We all are different! Rayhan’s DNA Zobayer’s DNA DNA fingerprinting overview

24. So…. How do we tell people apart just by their DNA anyways? DNA fingerprinting overview

25. The DNA gets cut up by special scissors DNA fingerprinting overview 

26. The scissors can only cut the same colour DNA fingerprinting overview 

27. All of the cut up pieces of DNA are different sizes DNA fingerprinting overview

28. A special machine sorts the DNA by size DNA fingerprinting overview

29. Our DNA has different sizes of pieces so it makes a different pattern when it’s all cut up DNA fingerprinting overview Rayhan’s DNA Zobayer’s DNA

30. DNA fingerprinting overview Rayhan’s DNA Zobayer’s DNA

31. Restriction fragment length polymorphism (RFLP) Polymerase chain reaction amplification of short tandem repeat (PCR/STR) Types of DNA fingerprinting

32. RFLP Types of DNA fingerprinting DNA extraction Restriction digestion Electrophoresis Transfer of DNA to membrane Hybridization of DNA X-ray

33. Southern blotting Types of DNA fingerprinting: RPLP

34. PCR/SRT Types of DNA fingerprinting

35. Multiplex PCR Types of DNA fingerprinting

36. 13 CODIS core STR loci with chromosomal position Types of DNA fingerprinting

37. Types of DNA fingerprinting Restriction fragment length polymorphism (RFLP) Polymerase chain reaction amplification of short tandem repeats (PCR/SRT) More sample needed Less sample needed Fresh DNA sample needed Fresh DNA sample not always mandatory No chance of amplification of contamination Chance amplification of contamination Require more time Require less time Analysis is costly. Analysis is cheap than RFLP

38. Single cell DNA fingerprint

39. DNA database http://www.investigativegenetics.com/content/4/1/22 1995 National DNA Database (NDNAD) 6 millions Combined DNA Index System (CODIS) 10 millions National DNA Database 16 millions

40. Future of DNA fingerprinting

41. DIY

42. goo.gl/4Gqgfb