Microsatellite

1. MicrosatelliteMicrosatellite
Dr Karan Veer SinghDr Karan Veer Singh
NBFGRNBFGR

2. What is a microsatellite?What is a microsatellite?
Tandemly repeated DNA (Tandemly repeated DNA (may see in the may see in the
literature as STRs - literature as STRs - Short tandem repeats)Short tandem repeats)
–Poly A/T most commonPoly A/T most common
–1-10 bp tandemly repeated = ‘1-10 bp tandemly repeated = ‘micromicro’ satellite’ satellite
–>10 = ‘>10 = ‘minimini’ satellite’ satellite
Types of microsatsTypes of microsats
–Di, tetra and tri nucleotide (Di, tetra and tri nucleotide (used in that orderused in that order))
–PerfectPerfect
–Imperfect/interruptedImperfect/interrupted
–CompoundCompound
Varying levels of variation associated with each typeVarying levels of variation associated with each type
Difficulty in scoringDifficulty in scoring

3. Short Tandem Repeats (STRs)
the repeat region is variable between samples while the
flanking regions where PCR primers bind are constant
7 repeats
8 repeats
AATG
Homozygote = both alleles are the same length
Heterozygote = alleles differ and can be resolved
from one another

4. Also called as STR, SSR, VNTR
Tandemly repeated DNA sequences with the
repeat/size of 1 – 6 bases repeated several
times
Highly polymorphic; can be analysed with the
help of PCR
Individual alleles at a locus differ in number
of tandem repeats of unit sequence owing to
gain of loss of one or more repeats and they
can be differentiated by electrophoresis
according to their size
Powerful DNA markers for quantifying genetic
variations within & between populations of a
species

5. Microsatellites – Types
Based on repeat pattern
•Perfect – CACACACACACACACACACACA
•Imperfect – CACACACACA CACACACA
CACACACA
6.Compound –
CACACACACACACA CATACATACATA CATACATACATA
•Complex – CACACACACACACACA
AATAATAATAATAATAATAAT

6. Based on number of base pairs
2)Mono (e.g. CCCCCCCC or AAAAAA)
3)Di (e.g. CACACACACA)
4)Tri (e.g. CCA CCA CCA CCA)
5)Tetra (e.g. GATA GATA GATA GATA GATA GATA GATA)
Minisatellites: - (9 – 65 base pairs repeated from 2
to several hundred times)
CGCCATTGTAGCCAATCCGGGTGCGATTGCAT CGCCATTGT
AGCCAATCCGGGTGCGATTGCAT CGCCATTGTAGCCAATCCGGG
TGCGATTGCAT CGCCATTGTAGCCAATCCGGGTGCGATTGCAT
CGCCATTGTAGCCAATCCGGGTGCGATTGCAT

7. Microsatellites – PropertiesMicrosatellites – Properties
Co-dominant
Inherit in Mendelian Fashion
Polymorphic loci with allele number as high as 14 – 15
per locus
Mostly reported from non-coding region, hence can be
independent of selection
Flanking region is highly conserved in related species
Can be obtained from small amounts of tissues [STR
analysis can be done on less than one billionth of a
gram (a nanogram) of DNA (as in a single flake of
dandruff)]
PAGE separation; silver staining/automated genotyping
Abundant in the eukaryote genome (~10
3
to 10
5
loci
dispersed at 7 to 10
100
kilobase pair (kb) intervals)

10. Microsatellites and Human DiseasesMicrosatellites and Human Diseases
Allele size variations in microsatellite loci in close
proximity (showing linkage disequilibrium) to the following
genes within the Human Major Histocompatibility Complex
(MHC) region
•IDDM (Insulin Dependent Diabetes Mellitus)
•Multiple Sclerosis (MS)
•Narcolepsy
•Uveitis
have been reported to cause genetic disorders; hence these
genetic disorders can be detected by screening the allele
sizes of the microsatellite loci (Type I markers) that are in
close proximity to these genes (Goldstein & Schlotterer,
2001)

11. The microsatellite, or short sequence repeat (SSR), is a
powerful genetic marker, useful in many areas of fish
genetics and breeding.
Polymorphic microsatellite loci have been frequently applied
to the analysis of genetic diversity,
population genetic structure, and
genomic mapping.
These co-dominant markers have also been applied to the
classification and systematics,
parentage identification,
germplasm conservation, and
breeding programme of food fish.

12. The zebrafish is the first vertebrate organism used for large-
scale genetic screens seeking genes critical to development.
1800 recessive mutations discovered to morphogenesis of the
vertebrate embryo. The cloning of the mutant genes depends on a
dense genetic map.
The 2000 markers, using microsatellite (CA) repeats,
provides 1.2-cM average resolution.
One centimorgan in zebrafish is about 0.74 megabase, so, for many
mutations, these markers are close enough to begin positional cloning
by YAC walks.

13. A Microsatellite Genetic Map of the Turbot (Scophthalmus maximus)
Genetics. 2007 December; 177(4): 2457–2467.
A consensus microsatellite-based linkage map was constructed from two
unrelated families. The mapping panel was derived from a gynogenetic family
of 96 haploid embryos and a biparental diploid family of 85 full-sib progeny
with known linkage phase.
A total of 242 microsatellites were mapped in 26 linkage groups.
The consensus map length was 1343.2 cM, with an average distance between
markers of 6.5 ± 0.5 cM.
The comparison of turbot microsatellite flanking sequences against
the Tetraodon nigroviridis genome revealed 55 significant matches, with a
mean length of 102 bp and high sequence similarity (81–100%).
This map will be suitable for QTL identification of productive traits in this
species and for further evolutionary studies in fish and vertebrate species.

14. Cloning and isolating genes:
Locating a gene is easy if the gene product (protein) is identified.
•Create a cDNA library using an expression vector.
•Probe with antibodies that bind the gene product.
•Isolate and sequence positive clones.
If the gene product is unknown, locating a gene is more difficult.
•Identify a marker (microsatellite, RFLP, SNPs) that is physically linked to
the gene on the same chromosome, and segregates in test crosses with the
disease phenotype (i.e., shows a strong statistical association).
•Use a technique called positional cloning to home in on gene.
e.g., cloning and discovery of the cystic fibrosis (CF) gene.

19. Markers SearchMarkers Search
Clicking on a marker type lets
you view a definition of that
marker type.
Clicking on “Search”
lets you search for
markers of that type.
These tables show a
breakdown of markers
in the database by
marker type.
1. Type marker
name. Use * for
wildcards.
Or Click to run
sample searches.
2. To refine search, specify a
marker type and/or a taxonomy
(species). For taxonomy use
common or scientific name.
3. Click “search
icon.”

20. •Sequence editing /Processing/ Submission
•Molecular data analysis (EditSeq, MegaBACE, CLUSTALW,BIOEDIT, MEGA 4, Arlequin)
•Phylogenetic analysis (PAUP,MOLPHY,MEGA,AMOVA)
2.Molecular Data Analysis using Genetic software
Genetic Diversity Studies of seahorse: Microsatellite

21. Sites of occurrences

22. Total 23 alleles
Genetic Tags
Stock specific Markers
Partitioning of Breeding Population
Limitation in Migration
No Gene Flow

23. No Mixing of Gene Pool
* Stock- Specific markers
* Genetic TAGs for selection programs
Total 11 Private Alleles

24. 25.0mLTotal volume
1.0mLTemplate DNA (25ng)
0.5mLTaq polymerase (Genei, Bangalore, India) (3Units/
ml)
0.5 mlMgCl
2
(1.5mM )
0.5mLPrimer (forward & reverse working solution) (total
conc. ~ 10.0 pmoles in 25ml of master mix)
2.0mLdNTPs (Genei, Bangalore, India) (200 mM)
2.5mLAssay buffer (10X; Genei, Bangalore, India)
(100mM Tris, 500mM KCl, 0.1% gelatin, pH9) (final
conc. 1X)
18.0mLDouble distilled water
Volume per
reaction
Microsatellites PCR reaction Mixture &
Concentration

26. Microsatellite PCRMicrosatellite PCR

27. :
:
:
:
:
3.5mLTEMED
70mL10% Ammonium persulphate
2mL5 x TBE
2mLDouble distilled water
5mLAcrylamide (19:1 acrylamide
and bisacrylamide)
10% non- denaturing Polyacrylamide gel 10% non- denaturing Polyacrylamide gel
electrophoresis (PAGE) to separate the PCR electrophoresis (PAGE) to separate the PCR
productsproducts

28. M 1 2 3 4 5 6 7 8 9 10 11 –ve M
Single Locus Microsatellites Single Locus Microsatellites
(PAGE & Silver staining; (PAGE & Silver staining;
There are five alleles at this locus) There are five alleles at this locus)
M: Standard molecular weight marker (M: Standard molecular weight marker ( pBRpBR322 DNA/322 DNA/MspMspI digest). I digest).
1 -11: Different individuals -ve : Negative control1 -11: Different individuals -ve : Negative control

29. Microsatellites- multiplexing &Microsatellites- multiplexing &
Use of Fluorescent dyesUse of Fluorescent dyes

30. A sample print-out for one person, showing all 16 loci
tested. Different colours help with interpretation
Automated Genotyping

31. Thanks
The Improbable seahorses,National Geography 1994