Power Point Presentation on Gene Expression and Regulation.ppt

The central dogma states that information in nucleic acid can be perpetuated or transferred, but the transfer of information form into protein is irreversible

1. The Central Dogma
The central dogma states
that information in nucleic
acid can be perpetuated or
transferred, but the transfer
of information form into
protein is irreversible.

2. Gene Expression and Regulation
Genes Can Be Expressed with Different Efficiencies at
Different Times and Environments

3. Translation
• The conversion of the information in the language of a
nucleid acid into the language of a protein
• Translation of the RNA message (mRNA) into a
polypeptide chain is catalyzed by the ribosome

4. The Ribosome
“Large protein-
manufacturing
machine”

5. The Prokaryotic Ribosome

6. The Genetic Code
• Generally, the correspondance between the
information stored in the language of nucleid acid and
protein
• Defines how the message is translated (”a nucleid acid
–amino acid dictionary”)
• More specifically, the correspondance between triplets
of nucleotides in the mRNA (read from 5’ to 3’) and
amino acids in protein (read from N-terminus to C-
terminus)

7. Triplet code (why?)
Codon = group of three
consecutive nucleotides = triplet
Start codon (in green)
• AUG
Stop codons (in orange)
• UAA, UAG, UGA
Redundant (usually the 3rd
nucleotide), because 61 codons
for 20 amino acids
The Genetic Code
4
n
> 20, when
n={3,4,5,...}

8. The Genetic Code
Three Conceivable Kinds of Genetic Codes

9. Interpretation of the Code
• The meaning of a codon that represents an amino acid is
determined by the tRNA that corresponds to it
• This requires base pairing between the codon in mRNA with the
anticodon of the tRNA within the ribosome
• The meaning of the termination codons is determined directly by
the protein factors
• Chemically similar amino acids are represented by related codons
to minimize the effect of mutations
• Identical in almost all living organisms (differences in the code of
mitochondrial DNA)

10. Transfer RNAs (tRNAs)
• Adaptor molecules that match amino acids to codons in mRNA
• Any cell contains different types of tRNA molecules sufficient to
incorporate all 20 amino acids into protein
• Some tRNAs can recognise more than one codon
• About 80 nucleotides in length

11. Structures of tRNAs
All tRNAs share a general
common structure that includes:
• an anticodon triplet loop
(pairs with mRNA codons)
• an acceptor stem
(to which the amino acid is
attached)

12. Structures of tRNAs

13. Coupling of amino acids to
tRNAs
1. The amino acid is accepted
by the aminoacyl-tRNA
synthetase enzyme and is
adenylated
2. The proper tRNA is
accepted by the enzyme and
the amino acid residue is
transferred to the 2’ or 3’ OH
of the 3’-terminal residue of
the RNA
Individual synthetase for each
amino acid and corresponding
tRNA(s)

14. Reading frames
6 reading frames (a–f) in dsDNA
(of course, only 3 in mRNA)
ORF = Open Reading Frame
From start codon to stop codon
5’ ATGTTTGCTGACGGTTTAACGGAAGGCGGAAACATGGCGAAGAAAAAACCAGTAGAAAAA 3’
---------+---------+---------+---------+---------+---------+
3’ TACAAACGACTGCCAAATTGCCTTCCGCCTTTGTACCGCTTCTTTTTTGGTCATCTTTTT 5’

a M F A D G L T E G G N M A K K K P V E K
b C L L T V * R K A E T W R R K N Q * K K
c V C * R F N G R R K H G E E K T S R K K
---------+---------+---------+---------+---------+---------+
d H K S V T * R F A S V H R L F F W Y F F
e N A S P K V S P P F M A F F F G T S F
f T Q Q R N L P L R F C P S S F V L L F

15. Structure of Prokaryotic mRNAs
mRNA has also regions that do not encode for a protein
Shine-Dalgarno sequence (SD) = Ribosome Binding Site (RBS)
The first AUG after SD-sequence is interpreted as the start site of
translation

16. Shine-Dalgarno Sequences
Help to align ribosomes on mRNA to properly start translation
Can base-pair with a sequence (ACCUCCUUA) contained in the
ribosomal RNA

17. The Mechanism of Translation
Initiation in Prokaryotes

18. The Mechanism of Translation
Elongation in Prokaryotes (1)
E = exit site
P = peptidyl binding site
A = aminoacyl binding site

19. The Mechanism of Translation
Elongation in Prokaryotes (2)
Binding of a specific amino
acid tRNA to A site

20. The Mechanism of Translation
Elongation in Prokaryotes (3)
Peptide bond formation:
chain transfer from
peptidyl tRNA to
aminoacyl tRNA

21. The Mechanism of Translation
Elongation in Prokaryotes (4)
Translocation of peptidyl
tRNA from A site to P
site. Ribosome moves one
codon to the right, and the
now uncharged tRNA
moves from P site to E
site.

22. The Mechanism of Translation
Elongation in Prokaryotes (5)
Ribosome is ready to start
another cycle.
The cycles will continue until
a termination codon is
reached.

23. The Mechanism of Translation
Termination in Prokaryotes

24. The Two Steps of Decoding
The genetic code is translated by means of two adaptors that
act one after another

25. Energetics of Translation
For a polypeptide of N residues, a minimum of 4N high energy
phosphates (such as ATP or GTP) must be hydrolysed.
Cellular peptide bond synthesis 160 kJ/mol.
Peptide bond synthesis in dilute solutions 20 kJ/mol.
Making a defined sequence of amino acids comes with an energy
cost.

26. The Regulation of Protein
Synthesis
When translation is regulated, it is generally done at the initiation
state:
1. The tertiary structure of the mRNA can prevent its attachment to
the ribosomal subunit
2. Proteins may bind to the mRNA, blocking initiation
3. Anti-sense RNA may block initiation