Transcription and translation

It's shortly tell about the Transcription and translation

1. TRANSCRIPTION AND TRANSLATION

2. TRANSCRIPTION: Transcription is the process by which DNA is transformed to mRNA. It involves two steps Pre messenger RNA is formed using the enzyme RNA polymerase . mRNA is edited from P remessenger RNA using Splicing.

3. Transcription Process:

4. Formation of PreMessenger RNA: The strand that contains the gene is called the sense strand , while the complementary strand is the antisense strand . When RNA polymerase binds to the sigma( σ )factor transcription starts and when it elongates “sigma” factor falls off . Then RNA Polymerase elongates without any factors . Again when it binds to the Row( ϸ ) factor transcription stops (stop signal) and one strand of premessenger RNA is formed .

5. Formation of mRNA after Splicing: SPLICING: The pre-messenger RNA thus formed contains introns (not required). The pre-messenger RNA is chopped up to remove the introns and create messenger RNA (mRNA) in a process called RNA splicing.

6. Template and Coding Strands 5’– T CAGC T CGC T GC T AA T GGCC–3’ 3’–AGTCGAGCGACGATTACCGG–5’ 5’– UCAGCUCGCUGCUAAUGGCC–3’ Sense (+) strand DNA coding strand Non-template strand DNA template strand antisense (-) strand RNA transcript transcription

7. Released mRNA

8. TRANSLATION: The mRNA formed in transcription is transported out of the nucleus, into the cytoplasm. In Translation information contained in mRNA is used to make the polypeptide. Here, it directs protein synthesis. Agents Involved: Transfer RNA ( tRNA ) is required for Translation. Ribosomes Release factor.

9. The process by which mRNA directs protein synthesis with the assistance of tRNA is called Translation. Nuclear membrane Transcription RNA Processing Translation DNA Pre-mRNA mRNA Ribosome Protein

10. STAGES OF TRANSLATION: There are three important stages in Translation process namely Initiation Elongation Termination

11. INITIATION: Initiation begins when small subunits of Ribosome attach to the Methylated cap of mRNA and moves to the Translation Initiation site. ie ) start codon ( AUG ) The tRNA that contain the anticodon ( UAC ) which is complementary with the mRNA codon to which it binds. The initiator tRNA carries Methionine.

12. ELONGATION : The aminoacid-tRNA is able to base pair with the next codon on the mRNA that binds at the “P” site associated with the Elongation Factor. The preceding aminoacid link with the incoming aminoacid using the Peptide Bond. The initiator tRNA is released from the P site.

13. TERMINATION : When Stop codon is encountered at the “A site” the Release Factor enters the A site and the translation is terminated. When the termination is reached the Ribosomes dissociates and forms Protein. GTP releases the Polypeptide from the ribosome.

14. THANK YOU Any comments ?