cisgenesis and intragenesis

it cover almost all content in cis/intragesis, right from introduction definition, explanation, production of marker free transgenic, intragenic vector construction, regulatory guide lines, current and future status, limitation, advantage over existing technique, swot analysis etc
its very useful for your seminar and presentations. it contain lot of picture, table, figure for your easy understanding

thank you
Mahesh

1. WELCOME 5/22/2015 1 MAHESH R HAMPANNAVAR MAHESH R HAMPANNAVAR Genetics and Plant breeding [email protected]

2. 2 Farmers fate , hungers and malnutrition are barriers in developing nations 5/22/2015 MAHESH R HAMPANNAVAR

3. 3 Breeder who facing failure to come up with potential variety 5/22/2015 MAHESH R HAMPANNAVAR

4. 4 Respect the nature Nature for our desire not for grid ……… 5/22/2015 MAHESH R HAMPANNAVAR

5. What is solution for all these? 5 5/22/2015 MAHESH R HAMPANNAVAR

6. Sisters in Innovative Plant Breeding Cisgenesis and Intragenesis; 6 5/22/2015 MAHESH R HAMPANNAVAR

7. Contents Introduction Definition Pre-requisite for cis/ intragenesis Case study Comparison Bio-safety measures Potential and disadvantage Conclusion 7 5/22/2015 MAHESH R HAMPANNAVAR

8. Environmentally sound and efficient production method Exclusive use genetic material from same species or related species why it require? 8 5/22/2015 MAHESH R HAMPANNAVAR

9. CISGENIC Schouten et al. (2006) “ A cisgenic is a crop plant that has been genetically modified with one or more genes isolated from crop plant” What is definition? 9 5/22/2015 MAHESH R HAMPANNAVAR

10. the intragenic concept as the isolation of specific genetic elements from a plant, recombination of these elements in vitro and insertion of the resulting expression cassettes into a plant belonging to the same sexual compatibility group INTRAGENIC Rommens et.al. (2004) 10 5/22/2015 MAHESH R HAMPANNAVAR

11. 11 5/22/2015 MAHESH R HAMPANNAVAR

12. cisgenic can harbour- What it contain ? 12 5/22/2015 MAHESH R HAMPANNAVAR

13. Intragenic can harbour- 13 5/22/2015 MAHESH R HAMPANNAVAR

14. . Within species or related spice What is similarities and difference? 14 5/22/2015 MAHESH R HAMPANNAVAR

15. Variations in definitions of coding-, regulatory-, border- and vector-backbone-sequences used for intragenesis and cisgenesis 15 5/22/2015 MAHESH R HAMPANNAVAR

16. What is Sources of genes ? Breeder gene pool Quaternary gene pool 16 5/22/2015 MAHESH R HAMPANNAVAR

17. What are all Pre requisites of cis/ intragenic plant? Sequence information of plant The isolation and characterization of gene of interest from crossable relatives Transformation technique Marker free transformation Intragenic vectors development 17 5/22/2015 MAHESH R HAMPANNAVAR

18. Web site address for data base info.. Database integrating genotypic and phenotypic data useful to finding candidate genomic regions involved in agronomic traits of interest Crop plant world wide web address Grass http://www.gramene.org/qtl/index.html Grape http://www.vitaceae.org Tomato http://164.107.85.47:8004/cgi-bin/_information.pl http://zamir.sgn.cornell.edu/Qtl/Html/home.htm Potato http://www.scri.ac.uk/research/genetics/GeneticsAndBreeding/potatoes/mappingqtls Cucurbitaceous www.icugi.org Rosaceous http://www.bioinfo.wsu.edu/gdr / Various http://www.phenome-networks.com/ 18 5/22/2015 MAHESH R HAMPANNAVAR

19. General scheme for the selection, confirmation and introduction of alleles from the breeder’s gene pool QTL mapping Fine mapping LD mapping Transient Assays(VIGS) New alleles TILLING/eco Translational genomics Phenomics synteny QTL maps BIBAC libraries transformation large fragment Validation of standard transfer Confirm gene of interest 19 5/22/2015 MAHESH R HAMPANNAVAR

20. Table . Examples of Traits That Can Be Incorporated into a Plant by either Transferring or Modifying the Expression of Native Genes ( Rommens , 2004) 20 5/22/2015 MAHESH R HAMPANNAVAR

21. Table . Examples of currently available native traits ( Rommens , 2004) 21 5/22/2015 MAHESH R HAMPANNAVAR

22. Transformational technique 22 5/22/2015 MAHESH R HAMPANNAVAR

23. 23 5/22/2015 MAHESH R HAMPANNAVAR

24. Co-transformation Borys Chong.et.al 24 5/22/2015 MAHESH R HAMPANNAVAR

25. Site-specific recombinase-mediated marker Targeted site Recombinase source lox Cre Bacteriophase P1 FTR FLP Saccharomyces cerevisiae RS RS Zygosaccharomyces rouxii Excised and lost Borys Chong.et.al 25 5/22/2015 MAHESH R HAMPANNAVAR

26. Transposon -based expelling systems Borys Chong.et.al 26 5/22/2015 MAHESH R HAMPANNAVAR

27. Methods used to produce marker-free intragenic/ cisgenic plants 27 5/22/2015 MAHESH R HAMPANNAVAR

28. Development of Intragenic vector Intragenic vector system is an extension of the minimal T-DNA vector system . Plasmid 28 5/22/2015 MAHESH R HAMPANNAVAR

29. 29 5/22/2015 MAHESH R HAMPANNAVAR

30. The P-DNA Approach Rommens et al . in 2004. A series of border specific degenerate primers, putative P-DNA’s were isolated from pooled DNA’s of 66 genetically diverse potato accessions by PCR. The amplified fragment were sequenced. And this information was used for inverse PCR with nested primers to determine the sequence of the border like regions. This information allowed the identification of sequences with sufficient similarity to Agrobacterium T-DNA border sequences. 30 5/22/2015 MAHESH R HAMPANNAVAR

31. A T-DNA-like region assembled from Petunia hybrida (petunia) ESTs Source- Euphytica (2007) 154:341–353 31 5/22/2015 MAHESH R HAMPANNAVAR

32. may horizontal gene transfer from bacteria T-DNA border-like sequences – rice, tomato, potato, Arabidopsis Replace - T-DNA for transformation 32 5/22/2015 MAHESH R HAMPANNAVAR

33. Disadvantages P-DNA Found in some species only . P-DNA Probability of finding such features on a single relatively short fragment in a plant genome is extremely small . Reduced frequencies of gene transfer. ( Rommens et al .2005) 33 5/22/2015 MAHESH R HAMPANNAVAR

34. Origin of replication The smallest known prokaryotic origins of replication are the 32-33bp Helper plasmid -provide specific factor for replication . The Col E- characterized by 2 direct repeat sequences of 7-9bp separated by 5-8bp . BLAST searches of plant ESTs with sequences similar to ColE2 or ColE3 identified in numerous species Bacteria Plasmid Ori of replication E.coli Colicin E2 ColE2 Shigella sp. Colicin E3 ColE3 34 5/22/2015 MAHESH R HAMPANNAVAR

35. Selectable Marker Derived from plant sequences . Mutant forms of the endogenous genes specific herbicides resistance . Over expression of the endogenous Atwbc19 ABC transporter gene confers kanamycin resistance ( Mentewab and Stewart 2005). For easy to transform crops such as potato, selectable marker genes are unnecessary (de Vetten et al.2003) 35 5/22/2015 MAHESH R HAMPANNAVAR

36. Considerations for Proper Design of Intragenic Vectors T-DNA not from regulatory(promoter ) elements of plants The DNA fragment should not derived from heterochromatic region. Significant length of 1-2kb of intragenic DNA occurs outside the left border. Small number of DNA fragments 36 5/22/2015 MAHESH R HAMPANNAVAR

37. 37 5/22/2015 MAHESH R HAMPANNAVAR

38. Objectives Improve the existing varieties with disease resistance Stacking of multiple R genes – broad spectrum resistance 38 5/22/2015 MAHESH R HAMPANNAVAR

39. Materials and Methods Plant materials Potato varieties –Atlantic , Bintje , potae9 Five Phytophthora infestans isolates and late blight resistance test European American Korean 39 5/22/2015 MAHESH R HAMPANNAVAR

40. Vector construction- Resistance governing genes Rpi-vnt 1.1- S . venturii Rpi-sto 1 - S. stoniliferum pBINPLUS – binary vector pBINAW2- modified form of pBINPLUS 40 5/22/2015 MAHESH R HAMPANNAVAR

41. 41 5/22/2015 MAHESH R HAMPANNAVAR

42. Potato transformation Explants – 4 week-old in vitro grown plants Pre cultured on R3B medium supplemented with PACM- for two days Explants were inoculated with agrobacterium strain AGL1+VirG+Binary plasmid –Two days Explants transferred to GCVK medium for shoot regeneration Shoot were transferred to CK medium for root regeneration Three week later rooted plantlets were analyzed through PCR for desired R Gene 42 5/22/2015 MAHESH R HAMPANNAVAR

43. DNA extraction and polymerase chain reaction Total genomic DNA was isolated from young leaves PCR positive for both R genes , PCR negative for back bone integration Reaction performed using DreamTaq TM standard PCR program (94°C for 60 s followed by 30 cycles of 94°C for 30 s, 58°C for 60 s, 72°C for 90 s and a final extension time of 5 min at 72°C). 43 5/22/2015 MAHESH R HAMPANNAVAR

44. Gene ID Sequences (5'-3') Fragment size ( bp ) Detection of Rpi-vnt1.1 forward ATGAATTATTGTGTTTACAAGACTTG 1100 T-DNA reverse AGCATTGGCCCAATTATCATTAAC Rpi-sto1 forward ACCAAGGCCACAAGATTCTC 890 T-DNA reverse CCTGCGGTTCGGTTAATACA tetA forward CTGCTAGGTAGCCCGATACG 396 Vector backbone reverse CCGAGAACATTGGTTCCTGT trfA forward CGTCAACAAGGACGTGAAGA 146 Vector backbone reverse CCTGGCAAAGCTCGTAGAAC NPTIII forward GAAAGCTGCCTGTTCCAAAG 162 Vector backbone reverse GAAAGAGCCTGATGCACTCC ColE1 forward ATAAGTGCCCTGCGGTATTG 246 Vector backbone reverse GCAGCCCTGGTTAAAAACAA oriV forward TGCGGCGAGCGGTATCAG 1045 Vector backbone reverse CTTCTTGATGGAGCGCATGGG traJ forward ACGAAGAGCGATTGAGGAAA 260 Vector backbone reverse CAAGCTCGTCCTGCTTCTCT Primers used for PCR analysis of transformants 44 5/22/2015 MAHESH R HAMPANNAVAR

45. Results Var/ strains IPO-C 90128 EC1 pic99189 DHD11 Atlantic S S S S S Bintje S S S S S potae9 S R R S S Dethatched leaf assay conducted for testing varieties 45 5/22/2015 MAHESH R HAMPANNAVAR

46. Selection and validation of cisgenic potato plant with two late blight R genes Cisgenic plant 46 5/22/2015 MAHESH R HAMPANNAVAR

47. 47 5/22/2015 MAHESH R HAMPANNAVAR

48. Detached leaf assays for cisgenic transformant H43-7. 48 5/22/2015 MAHESH R HAMPANNAVAR

49. 49 5/22/2015 MAHESH R HAMPANNAVAR

50. 50 5/22/2015 MAHESH R HAMPANNAVAR

51. Discussion average marker-free transformation frequency was 1.3% lower transformation frequency - larger T-DNA size (11 kb) [ Rpi-vnt1:Rpi-sto1] marker-free transformation is less prone to varietal differences than marker assisted transformation 51 5/22/2015 MAHESH R HAMPANNAVAR

52. A potential explanation could be that the presence of the NPTII gene directly next to the left border of the T-DNA would stimulate selection of higher levels of backbone integration 52 5/22/2015 MAHESH R HAMPANNAVAR

53. why appreciate this technique? 53 5/22/2015 MAHESH R HAMPANNAVAR

54. Conclusion of case study cisgenesis C.M. ROMMENS 2007 54 5/22/2015 MAHESH R HAMPANNAVAR

55. How cis /intragenic can overcome problems of introgression breeding? Cis/ intrgenic Conventional breeding 55 5/22/2015 MAHESH R HAMPANNAVAR

56. How cis /intragenic plants can overcome problems of transgenic plants? Cisgenesis/ intragenic Transgenesis 56 5/22/2015 MAHESH R HAMPANNAVAR

57. 57 5/22/2015 MAHESH R HAMPANNAVAR

58. Potential of these concept Improving traits with limited natural allelic variation Higher expression level of a trait Hybrid gene & silencing constructs. US and Europe, acceptable to a greater number of people than transgenic crops 58 5/22/2015 MAHESH R HAMPANNAVAR

59. Regulatory guidelines 59 5/22/2015 MAHESH R HAMPANNAVAR

60. Comparison hazards with other technique ( conventional, transgenic) The Panel concluded that- (i). Similar hazards can be associated with cisgenic and conventionally bred plants while (ii). Novel hazards can be associated with intragenic and transgenic plants. (iii). No new guidelines for risk assessment . 60 5/22/2015 MAHESH R HAMPANNAVAR

61. All of these breeding methods can produce - unintended effects . Unintended effect assessed case by case The risk to human and animal health and the environment will depend on exposure factor(cultivation and consumption) For cis and intragenesis less event-specific data are needed for the risk assessment EFSA journal 2012 61 5/22/2015 MAHESH R HAMPANNAVAR

62. Global overview of consequences of different new plant breeding techniques for the environment and for food and feed safety. 62 5/22/2015 MAHESH R HAMPANNAVAR

63. 63 5/22/2015 MAHESH R HAMPANNAVAR

64. Limitation of the two concepts Traits outside the sexually compatible gene pool cannot be introduced. Additional expertise and time Not clearly define Less transformation efficiency . 64 5/22/2015 MAHESH R HAMPANNAVAR

65. Objection and clarification Objection Random insertion of gene Mutation caused in plant Clarification Translocation breeding , Transposable element 2500 mutant varieties growing all around world in different crops 65 5/22/2015 MAHESH R HAMPANNAVAR

66. Current status of cis /intragenic crops In most countries, the release of cisgenic or intragenic crops currently falls under the same regulatory guidelines as transgenic crops The greatest expression of interest for less stringent regulations of these crops has been within the EU, the USA and New Zealand 66 5/22/2015 MAHESH R HAMPANNAVAR

67. Intragenic / cisgenic crops developed or currently under development 67 5/22/2015 MAHESH R HAMPANNAVAR

68. 68 5/22/2015 MAHESH R HAMPANNAVAR

69. Field trials with intragenic/ cisgenic crops 69 5/22/2015 MAHESH R HAMPANNAVAR

70. Future trends generation and commercialization of intragenic and cisgenic crops will depend on willingness to apply less stringent regulation to these crops worldwide 70 5/22/2015 MAHESH R HAMPANNAVAR

71. Manipulate crop within gene of same species Overcome existing methods in some aspects Strengths Low transformation efficiency Detail sequence study of crops Weaknesses Transgenic opposition consumer preference Opportunities Use of biotechnical tools questionable biosafety measures Threats SWOT Analysis of Cis / intragnic 71 5/22/2015 MAHESH R HAMPANNAVAR