Host Fungus Interactions Methods and Protocols 1st Edition Christoph Sasse

Visit https://ebookultra.com to download the full version and
explore more ebooks
Host Fungus Interactions Methods and Protocols
1st Edition Christoph Sasse
_____ Click the link below to download _____
https://ebookultra.com/download/host-fungus-
interactions-methods-and-protocols-1st-edition-
christoph-sasse/
Explore and download more ebooks at ebookultra.com

Here are some suggested products you might be interested in.
Click the link to download
Host Bacteria Interactions Methods and Protocols 1st
Edition Annette C. Vergunst
https://ebookultra.com/download/host-bacteria-interactions-methods-
and-protocols-1st-edition-annette-c-vergunst/
Host Pathogen Interactions Methods and Protocols 1st
Edition Christof R. Hauck (Auth.)
https://ebookultra.com/download/host-pathogen-interactions-methods-
and-protocols-1st-edition-christof-r-hauck-auth/
Host Microbe Interactions 1st Edition Michael San
Francisco And Brian San Francisco (Eds.)
https://ebookultra.com/download/host-microbe-interactions-1st-edition-
michael-san-francisco-and-brian-san-francisco-eds/
Analytical Methods in Supramolecular Chemistry 1st Edition
Christoph A. Schalley
https://ebookultra.com/download/analytical-methods-in-supramolecular-
chemistry-1st-edition-christoph-a-schalley/

DNA Protein Interactions Principles and Protocols 2nd
Edition. Edition Tom Moss
https://ebookultra.com/download/dna-protein-interactions-principles-
and-protocols-2nd-edition-edition-tom-moss/
DNA Protein Interactions Principles and Protocols Third
Edition Peter G. Stockley (Auth.)
https://ebookultra.com/download/dna-protein-interactions-principles-
and-protocols-third-edition-peter-g-stockley-auth/
Polyadenylation Methods and Protocols 1st Edition Joanna
Rorbach
https://ebookultra.com/download/polyadenylation-methods-and-
protocols-1st-edition-joanna-rorbach/
Microsatellites Methods and Protocols 1st Edition
Panagiotis Madesis
https://ebookultra.com/download/microsatellites-methods-and-
protocols-1st-edition-panagiotis-madesis/
Biofuels Methods and Protocols 1st Edition Shahabaddine
Sokhansanj
https://ebookultra.com/download/biofuels-methods-and-protocols-1st-
edition-shahabaddine-sokhansanj/

Host Fungus Interactions Methods and Protocols 1st
Edition Christoph Sasse Digital Instant Download
Author(s): Christoph Sasse, Joachim MorschhÃ¤user (auth.), Alexandra C.
Brand, Donna M. MacCallum (eds.)
ISBN(s): 9781617795398, 1617795399
Edition: 1
File Details: PDF, 11.34 MB
Year: 2012
Language: english

METHODS IN MOLECULAR BIOLOGY™
Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK
For further volumes:
http://www.springer.com/series/7651

Host-Fungus Interactions
Methods and Protocols
Edited by
Alexandra C. Brand
School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen,
Foresterhill, Aberdeen, UK
Donna M. MacCallum
School of Medical Sciences, Institute of Medical Sciences, University of Aberdeen,
Foresterhill, Aberdeen, UK

ISSN 1064−3745 e−ISSN 1940−6029
ISBN 978−1−61779−538−1 e−ISBN 978−1−61779−539−8
DOI 10.1007/978−1−61779−539−8
Springer New York Dordrecht Heidelberg London
Library of Congress Control Number: 2011945440
© Springer Science+Business Media, LLC 2012
All rights reserved. This work may not be translated or copied in whole or in part without the written permission
of the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013,
USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of
information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now
known or hereafter developed is forbidden.
The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified
as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights.
Cover illustration: Confocal microscopy of Candida albicans phagocytosis by J444.1 macrophages. Macrophage acidic
organelles are stained with LysoTracker Red (Invitrogen), and the fungal cells with FITC (Sigma). The image was captured
after 4 hours and shows C. albicans bound to and internalised within macrophages. Image courtesy of Leanne. E. Lewis.
Printed on acid−free paper
Humana Press is part of Springer Science+Business Media (www.springer.com)
Editors
Alexandra C. Brand, Ph.D.
School of Medical Sciences
Institute of Medical Sciences
University of Aberdeen
Foresterhill, Aberdeen, UK
[email protected]
Donna M. MacCallum, Ph.D.
School of Medical Sciences
Institute of Medical Sciences
University of Aberdeen
Foresterhill, Aberdeen, UK
[email protected]

v
Preface
The incidence and proﬁ le of fungal diseases affecting the human population has undergone
considerable change within recent decades, reﬂ ecting the availability of interventional medical
care and an increase in the prevalence of immunodeﬁ ciency syndromes. Microbiologists,
medical mycologists, immunologists, and biochemists are increasingly working together to
focus on the processes involved in the progression and treatment of fungal disease.  Host–
Fungus Interactions: Methods and Protocols is designed for research scientists who are
involved in this work and interested in undertaking new or comparative studies of interac−
tions between the mammalian host and clinically important fungal pathogens. The aim of
this book is to combine approaches for reverse genetics in pathogenic fungi with methods
for their application in in vitro and in vivo models of disease.
The study of fungal pathogenesis is hugely enhanced by the ability of researchers to
employ reverse genetics in the fungi of interest. The ﬁ rst section of this book, therefore,
provides methods for the culture and genetic manipulation of the primary fungal patho−
gens,  Histoplasma capsulatum, Coccidioides immitis , and  Paracoccidioides brasiliensis , and
the opportunistic pathogens,  Aspergillus fumigatus, Cryptococcus neoformans , and  Candida
albicans ; the latter group emerging as a major cause of morbidity and mortality in countries
where medical interventions are on the increase. Gene deletion, mutation, and regulatable
expression are valuable molecular tools that can reveal key virulence determinants during
interaction with the host. In addition, the use of ﬂ uorescently tagged proteins for cellular
localization and as expression reporters offers a wealth of information on fungal biology
and spatial/temporal events during infection. Previously, such approaches have been ham−
pered by the unavailability of genome sequences, lack of manipulatable sexual cycles, side
effects of using auxotrophic selectable markers, low efﬁ ciency of homologous reintegration,
and difﬁ culty in fungal transformation. In light of the need to understand emerging fungal
diseases, the past decade has seen signiﬁ cant advances in the availability of methods designed
to overcome these challenges in the study of pathogenic fungi, including genome availability
with improved annotation, whole−genome screening vectors, auxotrophy−independent
selectable markers, efﬁ cient mRNA ampliﬁ cation, RNAi knockdown, and the generation of
Ku
−
strains to yield high rates of homologous recombination.
The second section of this book focuses on methods for investigating host–fungus
interactions in model systems. Methods are described to investigate direct interactions
between host and fungal cells in vitro, using isolated host cells, cell lines, or tissue models
to evaluate host cell recognition and response to fungal cells. Such experiments offer a valuable
screening method to identify fungal mutants whose phenotypes warrant further investiga−
tion in vivo in infection models or allow speciﬁ c interactions to be further dissected. Key
methods are also described for determining host and fungal responses occurring during
infection, e.g., changes in gene expression. The ability to analyze transcriptional changes
during initiation and progression of fungal infection in model systems is greatly increasing
our understanding of these processes from the perspective of both host and fungus. Finally,
protocols for fungal infection models are described. Considerable progress has been made

vi Preface
in implementing the 3Rs (Replacement, Reﬁ nement, and Reduction) policy in host–fungus
interactions, and this section describes validated models for virulence studies using mini−
hosts, e.g., nematodes, fruit ﬂ ies, and wax moth larvae. These models allow some analysis
of host immune response; however, mammalian models are still required for more accurate
modelling of human infection. Protocols for a number of rodent models of invasive and
superﬁ cial fungal infection are described, which have been optimized for the study of dis−
ease progression and response to antifungal agents. The rodent models described cover not
only intravenous challenge but also inhalation models, which more accurately reﬂ ect the
infection route of many free−living pathogenic fungal species. Additional protocols describe
reﬁ ned infection models, such as the use of ﬂ uorescent fungi to allow live imaging of infec−
tion development, a catheter bioﬁ lm infection model, and a model of concurrent vaginal
and oral Candida albicans infection.
The aim of this volume is to describe available molecular methods and fungal infection
models in sufﬁ cient detail to encourage researchers to try new approaches to investigating
host–fungus interactions with conﬁ dence.
Foresterhill, Aberdeen, UK Alexandra C. Brand, Ph.D.
Donna M. MacCallum, Ph.D.

vii
Contents
Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi
PART I GENE DISRUPTION
1 Gene Deletion in Candida albicans Wild−Type Strains
Using the SAT1−Flipping Strategy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3
Christoph Sasse and Joachim Morschhäuser
2 Mini−blaster−Mediated Targeted Gene Disruption and Marker
Complementation in Candida albicans . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19
Shantanu Ganguly and Aaron P. Mitchell
3 Rapid Detection of Aneuploidy Following the Generation
of Mutants in Candida albicans  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
Megan D. Lenardon and André Nantel
4 Agrobacterium−Mediated Insertional Mutagenesis
in Histoplasma capsulatum  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
Olga Zemska and Chad A. Rappleye
5 Targeted Gene Disruption in Cryptococcus neoformans Using
Double−Joint PCR with Split Dominant Selectable Markers. . . . . . . . . . . . . . . 67
Min Su Kim, Seo-Young Kim, Kwang-Woo Jung,
and Yong-Sun Bahn
6 Multiple Gene Deletion in Cryptococcus neoformans Using
the Cre–lox System  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
Lorina G. Baker and Jennifer K. Lodge
7 Gene Disruption in Aspergillus fumigatus Using a PCR−Based
Strategy and In Vivo Recombination in Yeast  . . . . . . . . . . . . . . . . . . . . . . . . . 99
Iran Malavazi and Gustavo Henrique Goldman
8 Targeted Gene Deletion in Aspergillus fumigatus Using
the Hygromycin−Resistance Split−Marker Approach. . . . . . . . . . . . . . . . . . . . . 119
Fabrice N. Gravelat, David S. Askew, and Donald C. Sheppard
9 Gene Disruption in Coccidioides Using Hygromycin
or Phleomycin Resistance Markers. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Chiung-Yu Hung, Hua Zhang Wise, and Garry T. Cole
PART II MODULATION OF GENE EXPRESSION: RNAI GENE KNOCKDOWN
10 RNAi−Based Gene Silencing Using a GFP Sentinel System
in Histoplasma capsulatum  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151
Brian H. Youseff and Chad A. Rappleye

viii Contents
11 RNA Interference in Cryptococcus neoformans  . . . . . . . . . . . . . . . . . . . . . . . . . 165
Michael L. Skowyra and Tamara L. Doering
12 Gene Knockdown in Paracoccidioides brasiliensis
Using Antisense RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
João F. Menino, Agostinho J. Almeida, and Fernando Rodrigues
PART III MODULATION OF GENE EXPRESSION: REGULATABLE PROMOTERS
13 Tetracycline−Inducible Gene Expression in Candida albicans. . . . . . . . . . . . . . 201
Michael Weyler and Joachim Morschhäuser
14 Galactose−Inducible Promoters in Cryptococcus neoformans var. grubii. . . . . . . 211
Lorina G. Baker and Jennifer K. Lodge
15 Modular Gene Over−expression Strategies for Candida albicans  . . . . . . . . . . . 227
Vitor Cabral, Murielle Chauvel, Arnaud Firon, Mélanie Legrand,
Audrey Nesseir, Sophie Bachellier-Bassi, Yogesh Chaudhari,
Carol A. Munro, and Christophe d’Enfert
PART IV HOST RESPONSES TO INFECTION IN VITRO
16 Interactions Between Macrophages and Cell Wall Oligosaccharides
of Candida albicans  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247
Héctor M. Mora-Montes, Christopher McKenzie, Judith M. Bain,
Leanne E. Lewis, Lars P. Erwig, and Neil A.R. Gow
17 Murine Bone Marrow−Derived Dendritic Cells and T−Cell
Activation by Candida albicans. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 261
Joanne Gibson, Neil A.R. Gow, and Simon Y.C. Wong
18 Phagocytosis and Intracellular Killing of Candida albicans
by Murine Polymorphonuclear Neutrophils. . . . . . . . . . . . . . . . . . . . . . . . . . . 277
Alieke G. Vonk, Mihai G. Netea, and Bart Jan Kullberg
19 Human Oral Keratinocytes: A Model System to Analyze
Host–Pathogen Interactions  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 289
Torsten Wöllert, Christiane Rollenhagen, George M. Langford,
and Paula Sundstrom
20 Simple Assays for Measuring Innate Interactions with Fungi  . . . . . . . . . . . . . . 303
Ann M. Kerrigan, Maria da Glória Teixeira de Sousa,
and Gordon D. Brown
21 Binding and Uptake of Candida albicans by Human
Monocyte−Derived Dendritic Cells  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 319
Annemiek B. van Spriel and Alessandra Cambi
22 Immune Responses to Candida albicans in Models of In Vitro
Reconstituted Human Oral Epithelium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 333
Jeanette Wagener, Daniela Mailänder-Sanchez, and Martin Schaller
23 Analysis of Host−Cell Responses by Immunoblotting, ELISA,
and Real−Time PCR  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 345
David L. Moyes and Julian R. Naglik

ixContents
24 In Vitro Model of Invasive Pulmonary Aspergillosis
in the Human Alveolus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 361
Lea Gregson, William W. Hope, and Susan J. Howard
25 Biofilm Formation Studies in Microtiter Plate Format . . . . . . . . . . . . . . . . . . . 369
Marta Riera, Emilia Moreno-Ruiz, Sophie Goyard,
Christophe d’Enfert, and Guilhem Janbon
PART V FUNGAL RESPONSES DURING INFECTION
26 Transcript Profiling Using ESTs from Paracoccidioides brasiliensis
in Models of Infection. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 381
Alexandre Melo Bailão, Maristela Pereira,
Silvia Maria Salem-Izacc, Clayton Luiz Borges,
and Célia Maria de Almeida Soares
27 Laser Capture Microdissection of Candida albicans from Host Tissue. . . . . . . 397
Caroline Westwater and David A. Schofield
28 Isolation and Amplification of Fungal RNA for Microarray Analysis
from Host Samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 411
Anja Lüttich, Sascha Brunke, and Bernhard Hube
PART VI HOST RESPONSES TO INFECTION IN VIVO
29 Cytokine Measurement Using Cytometric Bead Arrays  . . . . . . . . . . . . . . . . . . 425
Luis Castillo and Donna M. MacCallum
30 Transcript Profiling of the Murine Immune Response
to Invasive Aspergillosis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 435
Zaneeta Dhesi, Susanne Herbst, and Darius Armstrong-James
PART VII N ON−MAMMALIAN MODEL SYSTEMS
FOR HOST–FUNGAL INTERACTIONS
31 Caenorhabditis elegans: A Nematode Infection Model
for Pathogenic Fungi  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 447
Maged Muhammed, Jeffrey J. Coleman, and Eleftherios Mylonakis
32 Drosophila melanogaster as a Model Organism for Invasive Aspergillosis. . . . . . 455
Michail S. Lionakis and Dimitrios P. Kontoyiannis
33 Galleria mellonella as a Model for Fungal Pathogenicity Testing  . . . . . . . . . . . 469
John Fallon, Judy Kelly, and Kevin Kavanagh
34 Embryonated Chicken Eggs as Alternative Infection Model
for Pathogenic Fungi  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 487
Ilse D. Jacobsen, Katharina Große, and Bernhard Hube
PART VIII MAMMALIAN HOSTS AS INFECTION MODELS
35 Mouse Intravenous Challenge Models and Applications  . . . . . . . . . . . . . . . . . 499
Donna M. MacCallum

x Contents
36 A Nebulized Intra−tracheal Rat Model of Invasive
Pulmonary Aspergillosis  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 511
Guillaume Desoubeaux and Jacques Chandenier
37 Invasive Models of Histoplasmosis  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 519
A. George Smulian
38 Murine Model of Concurrent Oral and Vaginal
Candida albicans Colonisation  . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 527
Durdana Rahman, Mukesh Mistry, Selvam Thavaraj,
Julian R. Naglik, and Stephen J. Challacombe
39 A Luciferase Reporter for Gene Expression Studies and Dynamic
Imaging of Superficial Candida albicans Infections . . . . . . . . . . . . . . . . . . . . . 537
Donatella Pietrella, Brice Enjalbert, Ute Zeidler, Sadri Znaidi,
Anna Rachini, Anna Vecchiarelli, and Christophe d’Enfert
40 Modeling of Fungal Biofilms Using a Rat Central Vein Catheter . . . . . . . . . . . 547
Jeniel E. Nett, Karen Marchillo, and David R. Andes
41 Orogastrointestinal Model of Mucosal and Disseminated Candidiasis  . . . . . . . 557
Karl V. Clemons and David A. Stevens
42 A Nonlethal Murine Cutaneous Model of Invasive Aspergillosis  . . . . . . . . . . . 569
Ronen Ben-Ami and Dimitrios P. Kontoyiannis
Index. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 583

xi
Contributors
AGOSTINHO   J.    A LMEIDA Life and Health Sciences Research Institute (ICVS),
School of Health Sciences , University of Minho , Braga , Portugal
D
AVID   R.    A NDES Division of Infectious Diseases, Department of Medicine
and Medical Microbiology and Immunology , University of Wisconsin ,
Madison , WI , USA
D
ARIUS    ARMSTRONG−JAMES Department of Microbiology and Department
of Infectious Diseases and Immunity , Imperial College , London , UK
D
AVID   S.    A SKEW Department of Pathology and Laboratory Medicine ,
University of Cincinnati , Cincinnati , OH , USA
S
OPHIE    BACHELLIER−BASSI Département Génomes et Génétique ,
Institut Pasteur, Unité Biologie et Pathogénicité Fongiques , Paris , France ;
INRA USC2019 , Paris , France
Y
ONG−SUN    BAHN Department of Biotechnology , College of Life Science
and Biotechnology, Yonsei University , Seoul , Korea
A
LEXANDRE   MELO    BAILÃO Laboratório de Biologia Molecular , Instituto de Ciências
Biológicas, ICBII, Campus II, Universidade Federal de Goiás , Goiás , Brazil
J
UDITH   M.    B AIN School of Medicine and Dentistry , University of Aberdeen ,
Aberdeen , UK
L
ORINA   G.    B AKER School of Science and Technology, Georgia Gwinett College,
Lawrenceville , GA , USA
R
ONEN    BEN−AMI Infectious Disease Unit , Tel Aviv Sourasky Medical Center ,
Tel Aviv , Israel
C
LAYTON   LUIZ    BORGES Laboratório de Biologia Molecular , Instituto de Ciências
Biológicas, ICBII, Campus II, Universidade Federal de Goiás , Goiás , Brazil
G
ORDON   D.    B ROWN Section of Immunology and Infection, Institute of Medical Sci-
ences, School of Medicine and Dentistry , University of Aberdeen , Aberdeen , UK
S
ASCHA    BRUNKE Department of Microbial Pathogenicity Mechanisms ,
Leibniz Institute for Natural Product Research and Infection Biology , Jena , Germany ;
Integrated Research and Treatment Center, Sepsis und Sepsisfolgen, Center for Sepsis
Control and Care (CSCC) , Universitätsklinikum Jena , Jena , Germany
V
ITOR    CABRAL Département Génomes et Génétique , Institut Pasteur,
Unité Biologie et Pathogénicité Fongiques , Paris , France ; INRA USC2019 ,
Paris , France
A
LESSANDRA    CAMBI Department of Tumor Immunology , Radboud University
Nijmegen Medical Centre , Nijmegen , The Netherlands
L
UIS    CASTILLO Departamento de Biología, Facultad de Ciencias ,
Universidad de La Serena , La Serena , Elqui , Chile
S
TEPHEN   J.    C HALLACOMBE Department of Oral Medicine , King’s College London
Dental Institute , London , UK

xii Contributors
JACQUES    CHANDENIER Parasitologie-Mycologie-Médecine tropicale , Centre Hospitalier
Régional et Universitaire , Tours , France
Y
OGESH    CHAUDHARI School of Medical Sciences , University of Aberdeen ,
Aberdeen , UK
M
URIELLE    CHAUVEL Département Génomes et Génétique , Institut Pasteur,
Unité Biologie et Pathogénicité Fongiques , Paris , France ; INRA USC2019 ,
Paris , France
K
ARL   V.    C LEMONS California Institute for Medical Research , San Jose , CA , USA ;
Division of Infectious Diseases, Department of Medicine , Santa Clara Valley
Medical Center , San Jose , CA , USA ; Division of Infectious Diseases and Geographic
Medicine, Department of Medicine , Stanford University , Stanford , CA , USA
G
ARRY   T.    C OLE Department of Biology and South Texas Center for Emerging
Infectious Diseases , University of Texas , San Antonio , TX , USA
J
EFFREY   J.    C OLEMAN Division of Infectious Diseases , Massachusetts General Hospital ,
Boston , MA , USA
C
HRISTOPHE   D’ENFERT Département Génomes et Génétique , Institut Pasteur,
Unité Biologie et Pathogénicité Fongiques , Paris , France ; INRA USC2019 ,
Paris , France
G
UILLAUME    DESOUBEAUX Parasitologie-Mycologie-Médecine tropicale ,
Centre Hospitalier Régional et Universitaire , Tours , France
Z
ANEETA    DHESI Department of Microbiology and Department of Infectious
Diseases and Immunity , Imperial College , London , UK
T
AMARA   L.    D OERING Department of Molecular Microbiology , Washington University
School of Medicine , St. Louis , MO , USA
B
RICE    ENJALBERT Institut National des Sciences Appliquées , Toulouse , France
L
ARS   P.    E RWIG School of Medicine and Dentistry , University of Aberdeen ,
Aberdeen , UK
J
OHN    FALLON Medical Mycology Unit , National University of Ireland , Maynooth ,
County Kildare , Ireland
A
RNAUD    FIRON Département Génomes et Génétique , Institut Pasteur,
Unité Biologie et Pathogénicité Fongiques , Paris , France ; INRA USC2019 ,
Paris , France
S
HANTANU    GANGULY Department of Biological Sciences , Carnegie Mellon University ,
Pittsburgh , PA , USA
J
OANNE    GIBSON School of Medicine and Dentistry , University of Aberdeen ,
Aberdeen , UK
G
USTAVO   HENRIQUE    GOLDMAN Departamento de Ciências Farmacêuticas,
Faculdade de Ciências Farmacêuticas de Ribeirão Preto , Universidade de São Paulo ,
São Paulo , Brazil
N
EIL   A.R.    G OW School of Medical Sciences , University of Aberdeen ,
Aberdeen , UK
S
OPHIE    GOYARD Institut Pasteur, Unité Biologie et Pathogénicité Fongiques ,
Paris , France
F
ABRICE   N.    G RAVELAT Department of Microbiology and Immunology ,
McGill University , Montréal , QC , Canada
L
EA    GREGSON The University of Manchester , Manchester , UK

xiiiContributors
KATHARINA    GROßE Department of Microbial Pathogenicity Mechanisms ,
Leibniz Institute for Natural Product Research and Infection Biology ,
Jena , Germany
S
USANNE    HERBST Department of Microbiology and Department of Infectious
Diseases and Immunity , Imperial College , London , UK
W
ILLIAM   W.    H OPE The University of Manchester , Manchester , UK
S
USAN   J.    H OWARD The University of Manchester , Manchester , UK
B
ERNHARD    HUBE Department of Microbial Pathogenicity Mechanisms ,
Leibniz Institute for Natural Product Research and Infection Biology ,
Jena , Germany ; Friedrich-Schiller University , Jena , Germany
C
HIUNG−YU    HUNG Department of Biology and South Texas Center for Emerging
Infectious Diseases , University of Texas , San Antonio , TX , USA
I
LSE   D.    J ACOBSEN Department of Microbial Pathogenicity Mechanisms ,
Leibniz Institute for Natural Product Research and Infection Biology ,
Jena , Germany
G
UILHEM    JANBON Institut Pasteur, Unité de Aspergillus , Paris , France
K
WANG−WOO    JUNG Department of Biotechnology, College of Life Science
and Biotechnology , Yonsei University , Seoul , Korea
K
EVIN    KAVANAGH Medical Mycology Unit , National University of Ireland ,
Maynooth , County Kildare , Ireland
J
UDY    KELLY Medical Mycology Unit , National University of Ireland , Maynooth ,
County Kildare , Ireland
A
NN   M.    K ERRIGAN Section of Immunology and Infection, Institute of Medical Sciences,
School of Medicine and Dentistry , University of Aberdeen , Aberdeen , UK
M
IN   SU    KIM Department of Biotechnology, College of Life Science and Biotechnology ,
Yonsei University , Seoul , Korea
S
EO−YOUNG    KIM Department of Biotechnology, College of Life Science
and Biotechnology , Yonsei University , Seoul , Korea
D
IMITRIOS   P.    K ONTOYIANNIS The University of Texas MD Anderson Cancer Center ,
Houston , TX , USA
B
ART   JAN    KULLBERG Department of Medicine , Radboud University Nijmegen
Medical Center , Nijmegen , The Netherlands
G
EORGE   M.    L ANGFORD Department of Biology , Syracuse University ,
Syracuse , NY , USA
M
ÉLANIE    LEGRAND Département Génomes et Génétique , Institut Pasteur,
Unité Biologie et Pathogénicité Fongiques , Paris , France ; INRA USC2019 ,
Paris , France
M
EGAN   D.    L ENARDON School of Medical Sciences , University of Aberdeen ,
Aberdeen , UK
L
EANNE   E.    L EWIS School of Medicine and Dentistry , University of Aberdeen ,
Aberdeen , UK
M
ICHAIL   S.    L IONAKIS Laboratory of Molecular Immunology , National Institute
of Allergy and Infectious Diseases , Bethesda , MD , USA
J
ENNIFER   K.    L ODGE Department of Molecular Microbiology , Washington University
School of Medicine , St. Louis , MO , USA
A
NJA    LÜTTICH Department of Microbial Pathogenicity Mechanisms , Leibniz Institute
for Natural Product Research and Infection Biology , Jena , Germany

xiv Contributors
DONNA   M.    M ACCALLUM School of Medical Sciences, Institute of Medical Sciences ,
University of Aberdeen , Foresterhill, Aberdeen , UK
D
ANIELA    MAILÄNDER−SANCHEZ Department of Dermatology , Eberhard Karls
University , Tuebingen , Germany
I
RAN    MALAVAZI Departamento de Genética e Evolução, Centro de Ciências
Biológicas e da Saúde (CCBS) , Universidade Federal de São Carlos (UFSCar) ,
São Carlos , SP , Brazil
K
AREN    MARCHILLO Division of Infectious Diseases, Department of Medicine
and Medical Microbiology and Immunology , University of Wisconsin ,
Madison , WI , USA
C
HRISTOPHER    MCKENZIE School of Medicine and Dentistry , University of Aberdeen ,
Aberdeen , UK
J
OÃO   F.    M ENINO Life and Health Sciences Research Institute (ICVS),
School of Health Sciences , University of Minho , Braga , Portugal ;
ICVS/3B’s PT Government Associate Laboratory , Guimarães , Portugal
M
UKESH    MISTRY Department of Oral Immunology , King’s College London
Dental Institute , London , UK
A
ARON   P.    M ITCHELL Department of Biological Sciences , Carnegie Mellon University ,
Pittsburgh , PA , USA
H
ÉCTOR   M.    M ORA−MONTES Departamento de Biología , Universidad de Guanajuato ,
Guanajuato , México
E
MILIA    MORENO−RUIZ Institut Pasteur, Unité Biologie et Pathogénicité Fongiques ,
Paris , France
J
OACHIM    MORSCHHÄUSER Institut für Molekulare Infektionsbiologie ,
Universität Würzburg , Würzburg , Germany
D
AVID   L.    M OYES Department of Oral Immunology , King’s College London
Dental Institute , London , UK
M
AGED    MUHAMMED Division of Infectious Diseases , Massachusetts General Hospital ,
Boston , MA , USA
C
AROL   A.    M UNRO School of Medical Sciences , University of Aberdeen , Aberdeen , UK
E
LEFTHERIOS    MYLONAKIS Division of Infectious Diseases , Massachusetts General
Hospital , Boston , MA , USA
J
ULIAN   R.    N AGLIK Department of Oral Immunology , King’s College London
Dental Institute , London , UK
A
NDRÉ    NANTEL Biotechnology Research Institute , National Research Council
of Canada , Montreal , QC , Canada
A
UDREY    NESSEIR Département Génomes et Génétique , Institut Pasteur,
Unité Biologie et Pathogénicité Fongiques , Paris , France ; INRA USC2019 ,
Paris , France
M
IHAI   G.    N ETEA Department of Medicine , Radboud University Nijmegen
Medical Center , Nijmegen , The Netherlands
J
ENIEL   E.    N ETT Division of Infectious Diseases, Department of Medicine and Medical
Microbiology and Immunology , University of Wisconsin , Madison , WI , USA
M
ARISTELA    PEREIRA Laboratório de Biologia Molecular , Instituto de Ciências Biológi-
cas, ICBII, Campus II, Universidade Federal de Goiás , Goiás , Brazil
D
ONATELLA    PIETRELLA Microbiology Section, Department of Experimental Medicine
and Biochemical Sciences , University of Perugia , Perugia , Italy

xvContributors
ANNA    RACHINI Microbiology Section, Department of Experimental Medicine
and Biochemical Sciences , University of Perugia , Perugia , Italy
D
URDANA    RAHMAN Department of Oral Immunology , King’s College London
Dental Institute , London , UK
C
HAD   A.    R APPLEYE Department of Microbiology , Ohio State University ,
Columbus , OH , USA
M
ARTA    RIERA Centre for Research in Agricultural Genomics (CRAG),
Campus UAB Bellaterra, Cerdanyola del Valles , Barcelona , Spain
F
ERNANDO    RODRIGUES Life and Health Sciences Research Institute (ICVS),
School of Health Sciences, University of Minho , Braga , Portugal ;
ICVS/3B’s PT Government Associate Laboratory , Guimarães , Portugal
C
HRISTIANE    ROLLENHAGEN VA Medical Center , White River Junction , VT , USA
S
ILVIA   MARIA    SALEM−IZACC Laboratório de Biologia Molecular , Instituto de Ciências
Biológicas, ICBII, Campus II, Universidade Federal de Goiás , Goiás , Brazil
C
HRISTOPH    SASSE Institut für Molekulare Infektionsbiologie , Universität Würzburg ,
Würzburg , Germany
M
ARTIN    SCHALLER Department of Dermatology , Eberhard Karls University ,
Tuebingen , Germany
D
AVID   A.    S CHOFIELD Guild Associates Inc. , Charleston , SC , USA
D
ONALD   C.    S HEPPARD Department of Microbiology and Immunology ,
McGill University , Montréal , QC , Canada
M
ICHAEL   L.    S KOWYRA Department of Molecular Microbiology , Washington University
School of Medicine , St. Louis , MO , USA
A.   G
EORGE    SMULIAN Infectious Disease Division, Cincinnati VA Medical Center ,
University of Cincinnati , Cincinnati , OH , USA
C
ÉLIA   MARIA   DE   ALMEIDA    SOARES Laboratório de Biologia Molecular , Instituto de
Ciências Biológicas, ICBII, Campus II, Universidade Federal de Goiás , Goiás , Brazil
M
ARIA   DA   GLÓRIA   TEIXEIRA   DE    SOUSA Laboratório de Micologia Médica,
Instituto de Medicina Tropical, Hospital das Clínicas, Faculdade de Medicina ,
Universidade de São Paulo , São Paulo , Brazil
A
NNEMIEK   B.   VAN    SPRIEL Department of Tumor Immunology , Radboud University
Nijmegen Medical Centre , Nijmegen , The Netherlands
D
AVID   A.    S TEVENS California Institute for Medical Research , San Jose , CA , USA;
Division of Infectious Diseases, Department of Medicine , Santa Clara Valley
Medical Center , San Jose , CA , USA; Division of Infectious Diseases and Geographic
Medicine, Department of Medicine , Stanford University , Stanford , CA , USA
P
AULA    SUNDSTROM Microbiology and Molecular Pathogenesis Program,
Dartmouth Medical School , Hanover , NH , USA
S
ELVAM    THAVARAJ Department of Oral Pathology , King’s College London
Dental Institute , London , UK
A
NNA    VECCHIARELLI Microbiology Section, Department of Experimental Medicine
and Biochemical Sciences , University of Perugia , Perugia , Italy
A
LIEKE   G.    V ONK Department of Medical Microbiology and Infectious Diseases ,
University Medical Center Rotterdam , Rotterdam , The Netherlands
J
EANETTE    WAGENER Department of Dermatology , Eberhard Karls University ,
Tuebingen , Germany

xvi Contributors
CAROLINE    WESTWATER Department of Craniofacial Biology , Medical University
of South Carolina , Charleston , SC , USA
M
ICHAEL    WEYLER Institut für Molekulare Infektionsbiologie , Universität Würzburg ,
Würzburg , Germany
H
UA   ZHANG    WISE Department of Biology and South Texas Center for Emerging
Infectious Diseases , University of Texas , San Antonio , TX , USA
T
ORSTEN    WÖLLERT Department of Biology , Syracuse University , Syracuse , NY , USA
S
IMON   Y.C.    W ONG Section of Immunology and Infection, School of Medicine
and Dentistry , University of Aberdeen , Aberdeen , UK
B
RIAN   H.    Y OUSEFF Department of Microbiology , Ohio State University ,
Columbus , OH , USA
U
TE    ZEIDLER Institut Pasteur, Unité Biologie et Pathogénicité Fongiques ,
Paris , France
O
LGA    ZEMSKA Department of Microbiology , Ohio State University ,
Columbus , OH , USA
S
ADRI    ZNAIDI Institut Pasteur, Unité Biologie et Pathogénicité Fongiques ,
Paris , France

Part I
Gene Disruption

3
Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_1, © Springer Science+Business Media, LLC 2012
Chapter 1
Gene Deletion in Candida albicans Wild-Type Strains
Using the SAT1 -Flipping Strategy
Christoph Sasse and Joachim Morschhäuser
Abstract
Targeted gene inactivation is an important method to investigate gene function. In the diploid yeast
Candida albicans , the generation of homozygous knock−out mutants requires the sequential replacement
of both alleles of a gene by a selection marker. Targeted gene deletion is often performed in auxotrophic
host strains, which are rendered prototrophic after the insertion of appropriate nutritional marker genes
into the target locus. The  SAT1 −ﬂ ipping strategy described in this chapter allows gene deletion in
prototrophic  C. albicans wild−type strains with the help of a recyclable dominant selection marker.
The  SAT1 ﬂ ipper cassette used for this purpose consists of the  caSAT1 marker, which confers resistance to
the antibiotic nourseothricin, and the  caFLP gene, which encodes the site−speciﬁ c recombinase FLP.
The addition of ﬂ anking sequences of the target gene allows speciﬁ c genomic insertion of the  SAT1 ﬂ ipper
cassette by homologous recombination and selection of nourseothricin−resistant transformants. Expression
of the FLP recombinase results in subsequent excision of the cassette, which is bordered by direct repeats
of the FLP recognition sequence  FRT , from the genome. The homozygous mutants obtained after two
rounds of insertion and recycling of the  SAT1 ﬂ ipper cassette differ from the wild−type parental strain only
by the absence of the target gene and can be used for the inactivation of additional genes and the generation
of complemented strains using the same strategy.
Key words:     Candida albicans ,  Dominant selection marker ,  Gene deletion ,  Knock−out mutants ,
Marker recycling ,  Nourseothricin resistance ,  Site−speciﬁ c recombinase

Candida albicans is a diploid organism without a known haploid
phase. To create mutants lacking a speciﬁ c gene, both alleles of the
gene have to be sequentially inactivated. This is usually performed
by transforming  C. albicans cells with linear DNA fragments
containing a selection marker that is ﬂ anked by the upstream and
downstream sequences of the target gene. Homologous recombi−
nation then results in replacement of one of the wild−type alleles in
1. Introduction

4 C. Sasse and J. Morschhäuser
the genome by the selection marker. Gene deletions are often
performed in auxotrophic host strains with defects in certain
biosynthetic pathways (e.g., for arginine, histidine, and uracil) that
can be complemented using the corresponding intact genes
(e.g., ARG4, HIS1, or URA3) as selection markers. Homozygous
mutants are obtained either by using different markers for the
inactivation of the two alleles in a host strain with multiple auxotro−
phies or by repeated use of a counterselectable, recyclable marker
(e.g.,  URA3 ) for sequential deletion of both alleles of the target
gene  (  1  ) . These methods are relatively straightforward, but they
also have drawbacks. First, their use is limited to laboratory strains
with appropriate auxotrophies. Therefore, they cannot be applied
to study the role of speciﬁ c genes in clinical isolates, which are usually
prototrophic. Yet, sometimes, the contribution of a gene to a certain
phenotype may not be revealed in laboratory strains. For example,
the multidrug efﬂ ux pump  MDR1  is not signiﬁ cantly expressed in
most strains under standard growth conditions, but it is constitu−
tively overexpressed in drug−resistant clinical isolates that have
acquired gain−of−function mutations in its regulator, the transcription
factor  MRR1 . While the inactivation of  MDR1  or  MRR1  in a
laboratory strain had no effect on drug susceptibility, the role of
these genes in drug resistance could be clearly demonstrated by
deleting them in  MDR1  overexpressing clinical isolates  (  2–  5  ) .
Second, the introduction of biosynthetic markers into an auxotrophic
host strain that does not contain these genes results in mutants that
cannot be directly compared with their parental strain, because
they differ not only by the absence of the target gene but also by
the presence of the selection markers. Therefore, this strategy
requires the inclusion of other control strains that contain the same
markers. Despite this, mutants and wild−type control strains still
usually differ by the genomic location of the markers (the target
locus in the mutants and the native locus or another integration
site in the control strain), which can affect the expression level
of the marker and the phenotype of the cells  (  6–  8  ) . When a coun−
terselectable, recyclable marker like  URA3  is used for sequential
gene disruptions, the resulting mutants are isogenic with the
auxotrophic parental strain. To restore prototrophy, the  URA3
gene is then often reinserted at a common genomic site in both the
parental and mutant strains to obtain truly isogenic strains  (  6  ) .
Complemented strains are obtained by reintegrating the target
gene together with the selection marker. It should be noted that,
in these cases, it is not the prototrophic mutants (which are usually
used for phenotypic analyses) but their auxotrophic progenitors
that were complemented.
The ﬁ rst dominant selection marker that became available for the
genetic manipulation of  C. albicans  was the mycophenolic acid (MPA)
resistance marker  MPA
R
, a mutated allele of the  C. albicans IMH3
gene  (  9  ) .  IMH3  encodes inosine monophosphate dehydrogenase,

51 Auxotrophy-Independent Gene Deletion in Candida albicans
a key enzyme in the de novo biosynthesis of guanine nucleotides
that is inhibited by MPA  (  10,   11  ) .  C. albicans  cells carrying a single
copy of the  MPA
R
  marker can grow in the presence of high concen−
trations of MPA that inhibit the growth of wild−type cells, allowing
the selection of MPA−resistant transformants of prototrophic
strains. Although the availability of the dominant  MPA
R
  marker
provided the opportunity to inactivate genes in any  C. albicans
strain (e.g., the  MDR1  gene in drug−resistant clinical isolates, see
above), the use of this marker is somewhat tedious. The selection
of MPA−resistant transformants takes a relatively long time (about
5–7 days). Additionally, the  MPA
R
  marker frequently integrates
into the endogenous  IMH3  locus, necessitating the screening of
many transformants to identify those in which a mutagenesis cassette
is inserted into the target gene. These limitations of the  MPA
R

marker were overcome with the development of a new selection
marker,  caSAT1 , which confers resistance to nourseothricin  (  12  ) .
Nourseothricin is a member of the streptothricin group of antibiotics
produced by  Streptomyces noursei   (  13  ) . The  sat-1  gene from the
bacterial transposon Tn 1825  encodes streptothricin acetyltransferase,
which confers resistance to nourseothricin by inactivating the
antibiotic  (  14,   15  ) . The  sat-1  gene was modiﬁ ed for functional
expression in  C. albicans , resulting in the  Candida- adapted  caSAT1
gene ( see   Note 1 ) that allowed the selection of nourseothricin−
resistant  C. albicans  transformants after genomic integration.
To enable efﬁ cient marker recycling for repeated use, the  caSAT1
marker was integrated into a cassette, the  SAT1  ﬂ ipper, which also
contains a  Candida −adapted  FLP  gene ( caFLP ), encoding the
site−speciﬁ c recombinase FLP, under the control of an inducible
promoter. The  SAT1  ﬂ ipper cassette is bordered by direct repeats
of the minimal FLP recombination target ( FRT ) sequence (Fig.  1 ).
After the addition of ﬂ anking sequences of the target gene, the
resulting deletion construct is used for the transformation of
the desired  C. albicans  host strain and the selection of nourseothri−
cin−resistant transformants in which the cassette had integrated
into one allele of the target gene by homologous recombination
(Fig.  2a ). Induction of  caFLP  expression results in FLP−mediated
excision of the  SAT1  ﬂ ipper cassette, which does not replicate and
is lost from the cells. The resulting nourseothricin−sensitive deriva−
tives can be identiﬁ ed by their slower growth on plates containing
a low concentration of nourseothricin; they form smaller colonies
than the original transformants (Fig.  2b ). The nourseothricin−
sensitive heterozygous mutants are then used for a second round
of integration and subsequent excision of the  SAT1  ﬂ ipper cassette
to obtain the homozygous mutants. Substitution of a complete copy
of the target gene for the upstream ﬂ anking region in the deletion
construct allows reintroduction of the gene into the homozygous
mutants using the same strategy, thereby generating complemented
strains. There are two versions of the  SAT1  ﬂ ipper available, with

6 C. Sasse and J. Morschhäuser
SAT1 flipper cassette
(contained in plasmid pSFS2)
NotISacIISacIKpnIApaIXhoI
FRTP
MAL2 caFLP T
ACT1 caSAT1 FRT
Deletion construct
Add target gene flanking sequences
Wild-type parental strain
Gene replacement
2
nd
round of gene replacement
SacII SacIApaI XhoI
5‘ FRTP
MAL2
caFLP T
ACT1
caSAT1 FRT 3‘
5‘ target gene ORF 3‘
Homologous
recombination
5‘ target gene ORF 3‘
Heterozygous mutant
(nourseothricin-resistant)
FLP-mediated excision
5‘ target gene ORF 3‘
5‘ FRTP
MAL2
caFLP T
ACT1
caSAT1 FRT 3‘
Heterozygous mutant
(nourseothricin-sensitive)
5‘ target gene ORF 3‘
5‘ FRT3‘
Homozygous mutant
(nourseothricin-resistant)
FLP-mediated excision
Homozygous mutant
(nourseothricin-sensitive)
5‘ FRT3‘
5‘ FRT3‘
5‘ FRTP
MAL2 caFLP T
ACT1 caSAT1 FRT 3‘
5‘ FRT3‘

71 Auxotrophy-Independent Gene Deletion in Candida albicans
Fig. 1. Construction of homozygous C. albicans mutants by targeted gene deletion using the SAT1 -ﬂ ipping strategy.
The structure of the SAT1 ﬂ ipper cassette is shown on top. The Candida -adapted FLP gene ( caFLP , light gray arrow ,
1,272 bp) is placed under the control of the inducible MAL2 promoter (P
MAL2
, bent arrow , 548 bp) and fused to the transcrip-
tion termination sequence of the ACT1 gene (T
ACT1
, bent line with circle , 388 bp). The caSAT1 marker (1,868 bp) is shown
as a hatched arrow and the 34-bp FLP recombination target ( FRT ) sites are indicated by the short black arrows . Unique
ﬂ anking restriction sites are indicated. The size of the whole SAT1 ﬂ ipper cassette contained in plasmid pSFS2 (from the
Kpn I site to the Sac I site) is 4,217 bp. In the example shown, upstream and downstream sequences of the target gene
( white boxes , labeled 5 ¢ and 3 ¢ ) are cloned as Apa I– Xho I and Sac II– Sac I fragments, respectively, on both sides of the SAT1
ﬂ ipper cassette to obtain the deletion construct, which can be excised from the vector backbone by digestion with Apa I
and Sac I. After the first round of transformation of the wild-type parental strain, nourseothricin-resistant clones are
obtained in which the open reading frame (ORF) of one allele of the target gene ( dark gray arrow ) is replaced by the SAT1
ﬂ ipper. FLP-mediated excision of the cassette results in nourseothricin-sensitive derivatives, which are then used for a
second round of integration/excision of the SAT1 ﬂ ipper to obtain homozygous mutants. Apart from the inactivation of the
target gene, the ﬁ nal mutants are identical to the wild-type parental strain.
Fig. 2. Selection of nourseothricin-resistant C. albicans transformants and screening for nourseothricin-sensitive derivatives
in which the SAT1 ﬂ ipper cassette was excised by FLP-mediated recombination. ( a ) A C. albicans wild-type strain was
transformed with a deletion construct containing the SAT1 ﬂ ipper cassette inserted between ﬂ anking sequences of a target
gene. The photograph was taken after 2 days of growth of the transformants at 30°C on a YPD plate containing 200 μ g/mL
nourseothricin. ( b ) Appearance of large colonies of a nourseothricin-resistant transformant and small colonies of nourseo-
thricin-sensitive derivatives which, after the induction of FLP expression, were grown for 2 days at 30°C on a YPD plate
containing 20 μ g/mL nourseothricin. ( c ) Growth of the parental wild-type strain (1), a nourseothricin-resistant transformant
(2), and a nourseothricin-sensitive derivative obtained after excision of the SAT1 ﬂ ipper cassette (3) on a YPD plate
containing 200 μ g/mL nourseothricin. The plates were incubated for 2 days at 30°C.
either the  SAP2  or the  MAL2  promoter controlling  caFLP
expression. The  SAP2  promoter can be induced by growing the
cells in media containing BSA as the sole nitrogen source, and
the  MAL2  promoter can be induced in media containing maltose
as carbon source. Both cassettes work equally well in our hands and
have been used for multiple gene deletions in different strain back−
grounds  (  2,   3,   12,   16–  23  ) . Here, we describe the use of the  SAT1
ﬂ ipper cassette with the  MAL2  promoter. The complete sequence
of this cassette has been deposited in GenBank under accession no.
AY524979.

8 C. Sasse and J. Morschhäuser

  1.    Plasmid pSFS2 (ca. 10  μ g of DNA from a miniprep in 50  μ L
H
2
O).
  2.    Appropriate restriction enzymes and buffers from supplier
( Apa I,  Xho I,  Sac II, and  Sac I).
  3.    DNA clean−up kit (see  Note 2 ).
  4.    Double−distilled H
2
O.
  5.    50× TAE buffer (1 L): 242 g Tris–HCl, 57.1 mL of acetic acid,
100 mL of 0.5 M EDTA (ethylene diamine tetraacetic acid),
pH 8.0; add H
2
O to 1 L.
  6.    DNA ligase and buffer.
  7.    Yeast peptone dextrose (YPD) medium: 1% yeast extract, 2%
peptone, 2% glucose.
  8.    YPD agar plates: YPD medium with 2% agar.
  9.    10× TE buffer: 100 mM Tris–HCl, pH 7.5, 10 mM EDTA.
  10.    1 M Lithium acetate, adjusted to pH 7.5 with acetic acid.
  11.    1 M Dithiothreitol (DTT).
  12.    1 M Sorbitol.
  13.    Electroporation cuvettes (Electroporation cuvette 2 mm,
Equibio).
  14.    Electroporator (Easyject Prima, Equibio).
  15.    200  μ g/mL Nourseothricin plates: dissolve 20 g peptone, 10 g
yeast extract, and 20 g agar in 900 mL double−distilled H
2
O.
After autoclaving, cool to approximately 60°C and add 100 mL
of a sterile 20% glucose solution. Add 2 mL of a 100 mg/mL
nourseothricin stock solution (clonNAT, Werner Bioagents,
Jena, Germany). The nourseothricin stock solution is stored at
−20°C. The nourseothricin must be thoroughly dissolved by
vortexing before use.
  16.    20  μ g/mL Nourseothricin plates (prepare as for 200  μ g/mL
nourseothricin plates but add only 200  μ L of the nourseothri−
cin stock solution per liter).
  17.    Yeast peptone maltose (YPM) medium: 1% yeast extract, 2%
peptone, and 2% maltose.
  18.    10× Phosphate−buffered saline (PBS) (1 L): 80 g NaCl, 2 g KCl,
14.4 g Na
2
HPO
4
⋅2H
2
O, and 2.4 g KH
2
PO
4
, add H
2
O to 1 L.
2. Materials

91 Auxotrophy-Independent Gene Deletion in Candida albicans

  1.    Design primers for the PCR ampliﬁ cation of 300–500 bp
sequences upstream and downstream of the target gene (see
Note 3 ). Incorporate suitable restriction sites in each primer to
facilitate directional cloning into plasmid pSFS2 (see  Note 4 ).
  2.    PCR−amplify the ﬂ anking sequences and perform a PCR clean−
up. Digest 2  μ g each of the PCR products and plasmid pSFS2
using the appropriate enzymes and buffers in 30  μ L reaction
volumes. In the example given in  Note 4 , the upstream PCR
product is digested with  Apa I and  Xho I, the downstream
PCR product is digested with  Sac I and  Sac II, and plasmid
pSFS2 is digested once with  Xho I and  Sac II to obtain the  SAT1
ﬂ ipper cassette and once with  Apa I and  Sac I to obtain the vec−
tor backbone.
  3.    Separate the DNA fragments by agarose gel electrophoresis on a
1% agarose gel overnight in 1× TAE buffer at 40 V. After
ethidium bromide staining, excise the desired fragments using a
sterile scalpel and purify them using a gel extraction kit. Dissolve
each of the DNA fragments in 10  μ L double−distilled H
2
O.
  4.    Set up a ligation reaction in a 25  μ L volume using 2.5  μ L of
the vector, 7  μ L of each ﬂ anking fragment (upstream and
downstream ﬂ anking sequences), 5  μ L of the  SAT1 ﬂ ipper
cassette, 2.5  μ L 10× ligation buffer, 1  μ L DNA ligase. Incubate
overnight at 16°C.
  5.    Transform competent  E. coli cells with the ligation mixture.
  6.    Plate onto LB plates containing 100  μ g/mL ampicillin to
select for positive transformants.
  7.    Check the plasmid construct by restriction enzyme digestion
and sequencing of the ﬂ anking upstream and downstream
fragments.
  8.    Excise the complete deletion cassette from the plasmid (in the
example given in Note 4 by digesting 5  μ g plasmid DNA for
3 h with 15 U  Apa I and 15 U  Sac I in a total volume of 50  μ L)
and separate the fragment from the vector by agarose gel elec−
trophoresis on a 1% agarose gel overnight in 1× TAE buffer at
40 V. After ethidium bromide staining, excise the fragment
containing the deletion cassette using a sterile scalpel and purify
it using a gel extraction kit. Dissolve the DNA in 6  μ L double−
distilled H
2
O.
3. Methods
3.1. Construction of
the Deletion Cassette

10 C. Sasse and J. Morschhäuser
  9.    Assess the quality and quantity of the eluted fragment by
analyzing 1  μ L of the sample on an agarose minigel together
with a known amount of a size marker. The remaining 5  μ L
will be used for electroporation and should contain at least
1  μ g of DNA for a successful transformation.
  1.    Inoculate 10 mL YPD with your  C. albicans host strain and
incubate overnight at 30°C with shaking at 250 rpm.
  2.    Inoculate 50 mL YPD in an Erlenmeyer ﬂ ask with 5  μ L of the
overnight culture and incubate overnight at 30°C with shaking
at 250 rpm.
  3.    When the culture has reached on optical density (OD
600 nm
) of
1.6–2.2, transfer the cells into a sterile 50 mL Falcon tube and
centrifuge for 5 min at 3,300 ×  g .
  4.    Discard the supernatant and resuspend the pellet in 8 mL
sterile double−distilled H
2
O.
  5.    Add 1 mL 10× TE buffer, pH 7.5, and mix.
  6.    Add 1 mL 1 M lithium acetate, pH 7.5, and mix.
  7.    Incubate for 1 h at 30°C with shaking at 150 rpm.
  8.    Add 250  μ L 1 M DTT and incubate with shaking at 150 rpm
for 30 min at 30°C.
  9.    Add 40 mL sterile, cold (4°C), double−distilled H
2
O, mix, and
centrifuge the cells for 5 min at 3,300 ×  g at 4°C.
  10.    Place the tube on ice and discard the supernatant. Resuspend
the cells in 25 mL sterile, cold, double−distilled H
2
O, and
centrifuge for 5 min at 3,300 ×  g at 4°C.
  11.    Resuspend the cells on ice in 1 mL sterile, cold 1 M sorbitol,
and centrifuge for 5 min at 3,300 ×  g at 4°C.
  12.    Discard the supernatant and resuspend the cells in the remaining
liquid to obtain a dense suspension (ca. 200  μ L).
  13.    Mix 40  μ L of the cell suspension with 5  μ L of the puriﬁ ed
DNA fragment containing the deletion cassette in a precooled
electroporation cuvette. Include a mock electroporation with−
out DNA.
  14.    Incubate the cuvette with the cells for 5 min on ice.
  15.    Place the electroporation cuvette into the Equibio electroporator.
Electroporate the cells at 1.8 kV and place the cuvette back
on ice.
  16.    Add 1 mL YPD medium to the cells, mix, and transfer the cell
suspension to a 2 mL Eppendorf tube (see  Note 5 ).
3.2. Transformation
of C. albicans
by Electroporation

111 Auxotrophy-Independent Gene Deletion in Candida albicans
    17.    Incubate the cells for 4 h at 30°C with shaking at 150 rpm
( see   Note 6 ).
    18.    Spread 100  μ L of the cell suspension on a YPD plate containing
200  μ g/mL nourseothricin. In addition, prepare a tenfold dilu−
tion series (not from the negative control) and spread 100  μ L
of the 10
−5
  and 10
−6
  dilutions on YPD plates without nourseo−
thricin to determine the number of viable cells ( see   Note 7 ).
    19.    Centrifuge the remaining cells for 2 min at 3,300 ×  g  and discard
the supernatant. Resuspend the cells in the remaining liquid
and spread them on a YPD plate containing 200  μ g/mL
nourseothricin ( see   Note 8 ).
    20.    Incubate the plates for 2 days at 30°C ( see  Fig.  2a  and Note 9).
    21.    Pick six nourseothricin−resistant colonies and streak them onto
a new YPD plate with 200  μ g/mL nourseothricin. Incubate
for 2 days at 30°C.
    22.    Analyze the clones for the desired allelic replacement by sequen−
tial Southern hybridizations using the upstream and downstream
ﬂ anking fragments of the disruption cassette as probes.
      1.    Pick a single colony of a clone containing the  SAT1  ﬂ ipper
cassette in one allele of the target gene from a selection plate.
Suspend the cells in 10 mL YPM in an Erlenmeyer ﬂ ask and incu−
bate overnight at 30°C with shaking at 250 rpm (see  Note 10 ).
    2.    Prepare a dilution series in 1× PBS and spread 100  μ L of the
10
−5
  and 10
−6
  dilutions on a YPD plate containing 20  μ g/mL
nourseothricin. Expect between 50 and 200 colony forming
units on the plates.
    3.    Incubate the plates for 2 days at 30°C. Cells that have lost the
SAT1  ﬂ ipper cassette and become nourseothricin−sensitive appear
as small colonies, whereas cells that have retained the  SAT1
ﬂ ipper will form large colonies ( see  Fig.  2b  and Note 11).
    4.    Pick several small colonies and restreak them on YPD plates
and also on YPD plates containing 200  μ g/ml nourseothricin.
Incubate the plates for 2 days at 30°C to conﬁ rm that the
clones are nourseothricin−sensitive. There should be no growth
at the high nourseothricin concentration, as in the original
wild−type parent (see Fig.  2c  and Note 12).
    5.    Verify correct excision of the  SAT1  ﬂ ipper cassette in
nourseothricin−sensitive clones by Southern hybridization
analysis. One correct nourseothricin−sensitive derivative of at
least two independent transformants is then used for a second
round of integration/excision of the  SAT1  ﬂ ipper cassette to
obtain homozygous mutants.
3.3. Excision of the
SAT1 Flipper Cassette

12 C. Sasse and J. Morschhäuser

     1.    We use the preﬁ x “ ca ” (lower case letters) to indicate that a
gene from another organism was modiﬁ ed for expression in
C. albicans , e.g.,  caSAT1  and  caFLP  are not the original  sat-1
and  FLP  genes from the bacterial transposon Tn 1825  and
Saccharomyces cerevisiae , respectively, but  Candida −adapted
genes. Some researchers have changed these gene designations
and use the preﬁ x “ Ca ” instead. This is inappropriate. According
to the guidelines provided at the  Candida  genome database
(  http://www.candidagenome.org/    ) the preﬁ x “ Ca ” (capital C)
should be used for  C. albicans  genes when it is necessary to
distinguish them from orthologous genes with the same names
from another organism.  CaSAT1  would, therefore, indicate
that the  SAT1  gene is from  C. albicans , which is not the case.
    2.    We use Nucleo Spin Extract II (Macherey−Nagel, Düren,
Germany).
    3.    We usually use ﬂ anking sequences of ca. 300–500 bp in length.
This is sufﬁ cient for speciﬁ c integration into the target locus
(usually 80–90% of the clones are correct, although the speci−
ﬁ city may be lower in some cases) and reduces the risk of PCR
errors that might affect neighboring genes. The cloned ﬂ anking
sequences should be conﬁ rmed by sequencing. Fragments of
this size can also be conveniently used as probes in Southern
hybridization analyses to conﬁ rm correct integration and exci−
sion of the  SAT1  ﬂ ipper cassette.
    4.    The  SAT1  ﬂ ipper cassette in plasmid pSFS2 was constructed in
the vector pBluescript II KS and was designed to contain several
unique restriction sites on the left ( Kpn I,  Apa I, and  Xho I) and
right ( Not I,  Sac II, and  Sac I) borders. These sites can be used
for cloning ﬂ anking sequences of the target gene that serve for
speciﬁ c genomic integration by homologous recombination.
For example, an upstream fragment is ampliﬁ ed by polymerase
chain reaction (PCR) with primers that introduce a distal  Apa I
site and a proximal  Xho I site, and a downstream fragment is
ampliﬁ ed with primers that introduce a proximal  Sac II site and
a distal  Sac I site. The fragments are then cloned into the appro−
priately digested pSFS2. The ﬂ anking sequences of the target
gene can be sequentially cloned on both sides of the  SAT1
ﬂ ipper cassette, e.g., by ﬁ rst inserting an  Apa I– Xho I fragment
with upstream ﬂ anking sequences on the left side, followed by
the insertion of a  Sac II– Sac I fragment with downstream ﬂ anking
sequences on the right side. In our lab, we usually construct
the deletion cassettes in a single cloning step  (  4,   5  ) . In most
cases, we perform a quadruple ligation with the  Apa I/ Sac I−
digested vector backbone, the  Xho I– Sac II  SAT1  ﬂ ipper fragment,
4. Notes

131 Auxotrophy-Independent Gene Deletion in Candida albicans
and the  Apa I– Xho I upstream and  Sac II– Sac I downstream
fragments, which directly generates the desired construct
(Fig.  3a ). Alternatively, if the target gene has already been
cloned into a plasmid, the coding region can be removed by
amplifying the vector backbone and ﬂ anking sequences by an
inverse PCR with divergent primers that introduce restriction
sites (e.g.,  Xho I and  Sac II), between which the  SAT1  ﬂ ipper
cassette can then be inserted (Fig.  3b ). Deletion cassettes can
also be generated by PCR ampliﬁ cation of the 4.2−kb  SAT1
ﬂ ipper cassette with long primers containing target gene
sequences. Although this is the fastest way to obtain the deletion
cassette, we do not use this method in our lab, because the
frequency of speciﬁ c integration into the target locus is much
lower and more transformants have to be screened. This
approach also requires the additional generation of probes to
verify correct integration and excision events by Southern
hybridization. Southern analysis should always be used for
mutant conﬁ rmation, because diagnostic PCR can be considered
only as a preliminary screening method. For reintroduction of
the target gene into the homozygous null mutants, the required
complementation cassette can also be easily obtained by substi−
tuting a PCR−ampliﬁ ed copy of the gene, including upstream
and transcription termination sequences, for the 5 ¢ −ﬂ anking
sequence in the deletion construct.
    5.    When starting the generation of mutants from a parental strain,
the cell suspension can be divided into two parts at this step.
Dividing the transformed cells into two separate suspensions
directly after the electroporation (i.e., before allowing them to
grow and divide) is a convenient way to obtain two indepen−
dent sets of transformants. We strongly recommend the gen−
eration of at least two independent series of mutants to ensure
the reproducibility of their phenotypes. Once independent
heterozygous mutants have been obtained, each of them can
be used to generate a homozygous mutant.
    6.    This recovery step is essential to enable the transformed cells to
express the streptothricin acetyltransferase encoded by the
caSAT1  gene. If plated immediately onto the selection plates,
the transformants would be killed by the nourseothricin before
they can express the resistance marker.
    7.    This is for troubleshooting in the event that no transformants
are obtained. Too many cells may have been killed by the
electroporation if conditions were not optimal. 100  μ L of the
10
−6
  dilution should contain viable cells that form colonies on
the YPD plate.
    8.    This plate is only required if the transformation efﬁ ciency is
low. In most cases, it can be discarded, because enough trans−
formants are normally recovered from the ﬁ rst plate on which

14 C. Sasse and J. Morschhäuser
Ligate
+
ApaIXhoI
5‘
SacIISacI
3‘
XhoI SacII
SAT1flipper
ApaI SacI
Vector
ApaIXhoI SacIISacI
+
ApaI SacI
5‘ Deletion cassette 3‘
Vector
a
b
Vector
Target gene
XhoI SacII
Inverse PCR
Vector
+
flanking sequences
XhoI SacII
XhoI SacII
SAT1flipper
+
Deletion cassette
Vector
Ligate
SAT1flipper
SAT1flipper
Fig. 3. Generation of a gene deletion construct with the SAT1 ﬂ ipper cassette in a single cloning step. ( a ) Construction of
the deletion cassette by a quadruple ligation reaction with the Apa I/ Sac I-digested vector backbone, an Xho I– Sac II fragment
containing the SAT1 ﬂ ipper cassette, and Apa I– Xho I and Sac II– Sac I fragments containing the PCR-ampliﬁ ed upstream (5 ¢ )
and downstream (3 ¢ ) sequences of the target gene. ( b ) Construction of the deletion cassette by inverse PCR using a plas-
mid with the cloned target gene and divergent primers ( small arrows ) that amplify the vector as well as ﬂ anking sequences
of the target gene. The primers introduce restriction sites (here Xho I and Sac II) between which the SAT1 ﬂ ipper cassette
can be inserted.

151 Auxotrophy-Independent Gene Deletion in Candida albicans
only 100  μ L of the cell suspension was plated. We usually
obtain 100–500 transformants with a gene deletion construct
that requires a double cross over for genomic integration.
    9.    Visible colonies appear after 24 h. If necessary, due to time
constraints, these can be picked, restreaked on a selection plate,
and be used in parallel to start an overnight culture for the
isolation of genomic DNA and Southern hybridization to
conﬁ rm correct integration. However, the larger colonies
obtained after 2 days are more convenient to handle and may
already reveal a phenotype, but be aware that colonies that
appear only after prolonged incubation (3 days and longer)
may be spontaneously resistant, untransformed cells. These do
not reach the same resistance level as cells containing the
caSAT1  marker and will also be found on the control plate
with cells to which no DNA was added. On the other hand,
certain mutants may have a slow−growth phenotype and require
more time to form visible colonies.
    10.    YPM medium, which contains maltose instead of glucose, is
used to induce the  MAL2  promoter that drives expression of
the  caFLP  gene. However, we found that the  MAL2  promoter
is leaky and the FLP recombinase is also expressed in YPD
medium. Therefore, recycling of the  SAT1  ﬂ ipper cassette can
usually also be achieved by growing the transformants overnight
in YPD medium without selective pressure. The population
will contain a sufﬁ cient percentage of cells that have lost the
SAT1  ﬂ ipper cassette. This is also apparent when the transfor−
mants are analyzed by Southern hybridization. If the cells were
grown without selective pressure for DNA isolation, the trans−
formants often exhibit not only the new fragment expected
after insertion of the  SAT1  ﬂ ipper cassette but also the frag−
ment resulting from excision of the cassette (both with variable
relative signal intensities). Growth in YPM, as described here,
induces the  MAL2  promoter more efﬁ ciently, although excision
of the  SAT1  ﬂ ipper cassette still does not occur in all cells of
the population (but this is not necessary, because only one
sensitive derivative is needed per transformant).
    11.    In our experience, the activity of nourseothricin can vary
between different batches. While a concentration of 200  μ g/mL
was always appropriate for the selection of nourseothricin−
resistant transformants, the concentration required to distin−
guish resistant and sensitive cells on the same plate is a bit
more tricky. On plates containing 20  μ g/mL nourseothricin,
both resistant and sensitive cells usually grow and can be dis−
tinguished by their colony size (Fig.  2b ). But sometimes we
had to lower the nourseothricin concentration to 10  μ g/mL,
because at higher concentrations the sensitive cells did not
grow at all. Conversely, on other occasions, the nourseothricin

16 C. Sasse and J. Morschhäuser
concentration had to be increased to 25  μ g/mL because at
lower concentrations the sensitive cells grew as well as the
resistant cells. We, therefore, recommend testing each new
batch of plates by streaking a sensitive and a resistant strain side
by side on the same plate to conﬁ rm that both grow and can
be distinguished. Alternatively, the cells can also be spread at
an appropriate dilution on YPD plates after the induction of
FLP expression. Among 50 randomly picked colonies that are
restreaked on both a YPD plate and a YPD plate containing
200  μ g/ml nourseothricin, several sensitive clones will usually
be found.
  12.    For conﬁ rming nourseothricin sensitivity, YPD plates contain−
ing 100  μ g/mL instead of 200  μ g/ml nourseothricin are also
sufﬁ cient. This requires an additional set of plates but reduces
costs, as nourseothricin is expensive.
Acknowledgment
Work in our laboratory is supported by the Deutsche Forschungs−
gemeinschaft (DFG).
References
  1.     Noble, S.M., Johnson, A.D. (2007) Genetics
of  Candida albicans , a diploid human fungal
pathogen.  Annu Rev Genet 41, 193–211.
  2.     Dunkel, N., Blass, J., Rogers, P.D., Morsch−
häuser, J. (2008) Mutations in the multi−drug
resistance regulator  MRR1 , followed by loss of
heterozygosity, are the main cause of  MDR1
overexpression in ﬂ uconazole−resistant  Candida
albicans strains.  Mol Microbiol 69, 827–840.
  3.     Morschhäuser, J., Barker, K.S., Liu, T.T., Blaß−
Warmuth, J., Homayouni, R., Rogers, P.D.
(2007) The transcription factor Mrr1p controls
expression of the  MDR1 efﬂ ux pump and
mediates multidrug resistance in  Candida albi-
cans .  PLoS Pathog 3, e164.
  4.     Morschhäuser, J., Michel, S., Staib, P. (1999)
Sequential gene disruption in  Candida albicans
by FLP−mediated site−speciﬁ c recombination.
Mol Microbiol 32, 547–556.
  5.     Wirsching, S., Michel, S., Morschhäuser, J.
(2000) Targeted gene disruption in  Candida
albicans wild−type strains: the role of the  MDR1
gene in ﬂ uconazole resistance of clinical
Candida albicans isolates.  Mol Microbiol 36,
856–865.
  6.     Brand, A., MacCallum, D.M., Brown, A.J.,
Gow, N.A., Odds, F.C. (2004) Ectopic expres−
sion of  URA3 can inﬂ uence the virulence
phenotypes and proteome of  Candida albicans
but can be overcome by targeted reintegration
of  URA3 at the  RPS10 locus.  Eukaryot Cell 3,
900–909.
  7.     Cheng, S., Nguyen, M.H., Zhang, Z., Jia, H.,
Handﬁ eld, M., Clancy, C.J. (2003) Evaluation
of the roles of four  Candida albicans genes in
virulence by using gene disruption strains that
express  URA3 from the native locus.  Infect
Immun 71, 6101–6103.
  8.     Lay, J., Henry, L.K., Clifford, J., Koltin, Y.,
Bulawa, C.E., Becker, J.M. (1998) Altered
expression of selectable marker  URA3 in gene−
disrupted  Candida albicans strains complicates
interpretation of virulence studies.  Infect
Immun 66, 5301–5306.
  9.     Wirsching, S., Michel, S., Köhler, G., Morsch−
häuser, J. (2000) Activation of the multiple
drug resistance gene  MDR1 in ﬂ uconazole−
resistant, clinical  Candida albicans strains is
caused by mutations in a  trans −regulatory factor.
J Bacteriol 182, 400–404.

171 Auxotrophy-Independent Gene Deletion in Candida albicans
   10.     Köhler, G.A., Gong, X., Bentink, S., Theiss, S.,
Pagani, G.M., Agabian, N., Hedstrom, L.
(2005) The functional basis of mycophenolic
acid resistance in  Candida albicans IMP dehy−
drogenase.  J Biol Chem 280, 11295–11302.
   11.     Köhler, G.A., White, T.C., Agabian, N. (1997)
Overexpression of a cloned IMP dehydrogenase
gene of  Candida albicans confers resistance
to the specific inhibitor mycophenolic acid.
J Bacteriol 179, 2331–2338.
   12.     Reuß, O., Vik, Å., Kolter, R., Morschhäuser, J.
(2004) The  SAT1 ﬂ ipper, an optimized tool for
gene disruption in  Candida albicans .  Gene
341, 119–127.
   13.     Krügel, H., Fiedler, G., Haupt, I., Sarfert, E.,
Simon, H. (1988) Analysis of the nourseothricin−
resistance gene ( nat ) of  Streptomyces noursei .
Gene 62, 209–217.
   14.     Heim, U., Tietze, E., Weschke, W., Tschäpe,
H., Wobus, U. (1989) Nucleotide sequence of
a plasmid born streptothricin−acetyl−transferase
gene ( sat-1 ).  Nucleic Acids Res 17, 7103.
   15.     Joshi, P.B., Webb, J.R., Davies, J.E., McMaster,
W.R. (1995) The gene encoding streptothricin
acetyltransferase ( sat ) as a selectable marker for
Leishmania expression vectors.  Gene 156,
145–149.
   16.     Coste, A., Turner, V., Ischer, F., Morschhäuser,
J., Forche, A., Selmecki, A., Berman, J., Bille,
J., Sanglard, D. (2006) A mutation in Tac1p, a
transcription factor regulating  CDR1 and
CDR2 , is coupled with loss of heterozygosity
at chromosome 5 to mediate antifungal resis−
tance in  Candida albicans
.  Genetics 172,
2139–2156.
   17.     Dabas, N., Morschhäuser, J. (2007) Control of
ammonium permease expression and ﬁ lamentous
growth by the GATA transcription factors
GLN3 and  GAT1 in Candida albicans.  Eukaryot
Cell 6, 875–888.
  18.     Dabas, N., Morschhäuser, J. (2008) A transcrip−
tion factor regulatory cascade controls secreted
aspartic protease expression in  Candida albicans .
Mol Microbiol 69, 586–602.
   19.     Dunkel, N., Liu, T.T., Barker, K.S., Homayouni,
R., Morschhäuser, J., Rogers, P.D. (2008) A
gain−of−function mutation in the transcription
factor Upc2p causes upregulation of ergosterol
biosynthesis genes and increased ﬂ uconazole
resistance in a clinical  Candida albicans isolate.
Eukaryot Cell 7, 1180–1190.
   20.     Lermann, U., Morschhäuser, J. (2008) Secreted
aspartic proteases are not required for invasion
of reconstituted human epithelia by  Candida
albicans .  Microbiology 154, 3281–3295.
  21.     Ramírez−Zavala, B., Reuß, O., Park, Y.−N., Ohlsen,
K., Morschhäuser, J. (2008) Environmental
induction of white−opaque switching in  Candida
albicans .  PLoS Pathog 4, e1000089.
   22.     Reuß, O., Morschhäuser, J. (2006) A family of
oligopeptide transporters is required for growth
of  Candida albicans on proteins.  Mol Microbiol
60, 795–812.
   23.     Staib, P., Lermann, U., Blaß−Warmuth, J.,
Degel, B., Würzner, R., Monod, M.,
Schirmeister, T., Morschhäuser, J. (2008)
Tetracycline−inducible expression of individual
secreted aspartic proteases in  Candida albicans
allows isoenzyme−speciﬁ c inhibitor screening.
Antimicrob Agents Chemother
52, 146–156.

19
Alexandra C. Brand and Donna M. MacCallum (eds.), Host-Fungus Interactions: Methods and Protocols,
Methods in Molecular Biology, vol. 845, DOI 10.1007/978-1-61779-539-8_2, © Springer Science+Business Media, LLC 2012
Chapter 2
Mini-blaster-Mediated Targeted Gene Disruption
and Marker Complementation in Candida albicans
Shantanu Ganguly and Aaron P. Mitchell
Abstract
Several gene disruption strategies have been described in  Candida albicans  to create homozygous mutants.
We describe here a recyclable mini−blaster cassette containing  C. albicans URA3  gene and 200−bp ﬂ anking
repeats that is useful for disruption of  C. albicans  genes. The cassette can be used to create unmarked
homozygous mutants which can be complemented at the  HIS1  gene locus. This strategy of creating gene
disruptions and subsequent complementation can be used to study gene function.
Key words:   Genetics ,  Mutants ,  Complementation

  Candida albicans  is a major fungal systemic pathogen in humans.
The ability of this fungus to cause lethal infections has fueled the
need to study its gene function to better understand aspects such as
host−pathogen interactions and virulence. The genetic architecture
of this pathogen poses two signiﬁ cant obstacles  (  1  ) . First,  C .  albicans
is a diploid so both alleles of a gene must be altered. Second, it is an
asexual organism, so gene disruption and complementation depends
upon successive manipulations of a single strain.
Loss−of−function or null mutations provide a simple avenue
toward interpretation of gene function. In this chapter, we discuss
a detailed protocol to introduce a null mutation in a  C. albicans
gene of interest. We describe use of the mini−blaster strategy to
delete both alleles of a gene by alternate transformation and
recombination using a recyclable cassette containing the  C. albicans
URA3  marker  (  2  ) . This strategy is based on the original Ura−blaster
design of Alani and Kleckner  (  3  )  that was modiﬁ ed for  C. albicans
1. Introduction

20 S. Ganguly and A.P. Mitchell
by Fonzi and Irwin  (  4  ) . The mini−blaster, or “Ura−blaster,” has
shorter direct repeats than the Ura−blaster, thus facilitating PCR
ampliﬁ cation. Speciﬁ cally, the mini−blaster cassette carries the
URA3-dpl200  marker (Fig.  1 ), which constitutes the  URA3  gene
and 200−bp ﬂ anking repeats. The ﬂ anking repeats permit homolo−
gous excision and reutilization of the  URA3  marker. The cassette
is ampliﬁ ed and targeted using primers bearing 100 bp of
homology to the gene locus. These same primers may be used for
a more conventional dual−marker gene disruption procedure  (  5  ) .
Transformation with the PCR product confers a Ura + phenotype,
creating a heterozygous mutant with one allele of the targeted
gene replaced by the cassette. Subsequent growth of the
Ura + heterozygote under nonselective conditions, followed by
selection on 5−FOA (5−ﬂ uoroorotic acid) plates, yields a Ura−
heterozygous strain. 5−FOA is used for identiﬁ cation and selection
of cells that have undergone spontaneous loss of  URA3  to become
Ura−. Cells that have retained  URA3  can synthesize the enzyme
orotidine−5 ¢ −phosphate decarboxylase, which converts 5−FOA into
a toxic compound and therefore renders Ura + cells unable to grow
on plates containing 5−FOA. Transformation and 5−FOA selection
are repeated with the Ura− heterozygote to delete the second allele
of the gene, thus generating an unmarked homozygous mutant.
Additionally, we describe how use of a distinct primer set for dele−
tion of the second allele can minimize same−allele integration of
the cassette in the heterozygous mutant.
The mini−blaster strategy enables one to generate unmarked
deletion mutants, thus permitting creation of multiply mutant strains.
URA3
Mini Blaster Cassette
in pDDB57 plasmid
Loop Out Product
3.0 kb
2.0 kb
1.5 kb
1.0 kb
0.5 kb
Mini Blaster Product
1 2 3 4 5
Fig. 1. PCR ampliﬁ cation of the mini-blaster cassette from the pDDB57 plasmid. Gray
boxes in the diagram indicate the 200 bp repeats ﬂ anking the URA3 ORF. In the gel picture,
lanes 1–5 show the ~2,000-bp long cassette and a ~750-bp long loop-out product.

212 Mini-blaster-Mediated Gene Disruption in C. albicans
This strategy is particularly important for deleting genes with similar
sequences or overlapping function where mutations for two or more
similar genes in the same background are required to assess gene
function. Complementation with a wild−type gene copy in these
strains can be carried out at the  HIS1  gene locus, using vector
pDDB78  (  6  ) . We note that pDDB78−based complementation can
also be used for homozygous mutants created with  ARG4  and  URA3
cassettes in the BWP17 strain background  (  5  ) . We discuss the
complementation procedure as well. Phenotypic analysis following
complementation of each of the genes individually in the deletion
background can provide assessment of individual gene function.

      1.    Primer set 1 for disrupting ﬁ rst allele of a gene:
   F1 (forward primer 1): 100 bp upstream of start codon + adapter
sequence (T TTC CCA GTC ACG ACG TT)
    R1 (reverse primer 1): 100 bp downstream of stop codon
(reverse complement) + adapter sequence (G TGG AAT TGT
GAG CGG ATA).
    2.    Primer set 2 for disrupting second allele (optional):
   F2 (forward primer 2): 100 bp downstream of start
codon + adapter sequence (T TTC CCA GTC ACG ACG TT)
    R2 (reverse primer 2): 100 bp upstream of stop codon
(reverse complement) + adapter sequence (G TGG AAT TGT
GAG CGG ATA).
    3.    Detect primers to conﬁ rm cassette integration at the targeted
locus.
    4.    Complementation primers for complementing the homozygous
mutant with a wild−type copy of the deleted gene.
      1.    LB + ampicillin (100 μ g/mL) liquid medium: 0.5% yeast
extract, 1% NaCl, 1% tryptone, 100  μ g/mL ampicillin.
    2.    Plasmid DNA Miniprep Kit (Fermentas GeneJET™ Plasmid
Miniprep Kit).
      1.    10  μ M forward primer (F1).
    2.    10  μ M reverse primer (R1).
    3.    10×  Ex Taq  Buffer PCR buffer (contains 20 mM Mg
2+
).
    4.    dNTPs (2.5 mM each).
    5.     TaKaRa Ex Taq™  DNA polymerase (Takara Bio, Inc.).
    6.    Template Plasmid: pDDB57, Pubmed accession number:
AF173953  (  2  ) .
2. Materials
2.1. Primer Design
2.2. Escherichia coli
Plasmid Extraction/
Puriﬁ cation
2.3. PCR Reaction
to Amplify
the Mini-blaster
Cassette

22 S. Ganguly and A.P. Mitchell
      1.     C. albicans  strain BWP17  (  5  ) .
    2.    YPD + Uri (80 μ g/mL) plates: 2% glucose, 2% bacto−peptone,
1% bacto−yeast extract, 2% bacto−agar, 80  μ g/mL of uridine.
    3.    YPD + Uri (80 μ g/mL) liquid medium: 2% glucose, 2% bacto−
peptone, 1% bacto−yeast extract, 80  μ g/mL of uridine.
    4.    Ura−blaster cassette PCR product.
    5.    LATE (0.1 M LiOAc in 1× TE buffer): 0.372 g/L EDTA diso−
dium salt, 1.21 g/L Tris, 10.2 g/L lithium acetate, pH 7.5.
    6.    Calf thymus DNA (~10 mg/mL).
    7.    PLATE (8 mL 50% w/v PEG
3350
  + 1 mL 10× TE + 1 mL 1 M
LiOAc): For 50% w/v PEG
3350
, dissolve 50 g PEG
3350
  in 100 mL
(ﬁ nal volume) distilled water and ﬁ lter sterilize after mixing; For
10× TE, 3.72 g/L 1 mM EDTA disodium salt, 12.1 g 10 mM
TRIS, pH 7.5; For 1 M LiOAc 102 g/L lithium acetate pH 7.5.
    8.    CSM−URA plates: 2% glucose, 0.67% yeast nitrogen base
(without amino acids), 0.077% of CSM−URA dropout medium,
2% bacto−agar.
      1.    YPD + Uri (80 μ g/mL) liquid medium (see Subheading  2.4 ,
item 3).
    2.    CSM−URA + 5FOA (1 g/L) plates: 2% glucose, 0.67% yeast
nitrogen base (without amino acids), 0.077% CSM−URA drop−
out medium, 2% bacto−agar, 5−FOA (1 g/L).
    3.    YPD + Uri (80 μ g/ μ L) plates (see Subheading  2.4 ,  item 2 ).
      1.    10  μ M forward detect primer (FD1).
    2.    10  μ M reverse detect primer (RD1).
    3.    10× PCR buffer with Mg
2+
: contains 100 mM Tris–HCl pH 9,
15 mM MgSO
4
, 100 mM KCl, 80 mM (NH
4
)
2
SO
4
, 0.5%
NP−40; ﬁ nal MgCl
2
  concentration of 1.5 mM.
    4.    dNTPs.
    5.     Taq  DNA polymerase.
      1.    10  μ M forward primer (F1 or F2, if desired).
    2.    10  μ M reverse primer (R1 or R2, if desired).
    3.    10×  Ex Taq  Buffer PCR buffer (contains 20 mM Mg
2+
).
    4.    dNTPs (2.5 mM each).
    5.        TaKaRa Ex Taq™  DNA polymerase.
    6.    Template Plasmid: pDDB57  (  2  ) .
2.4. Transformation
of the Mini-blaster
Cassette into
C. albicans
2.5. Marker Recycling
Step
2.6. Conﬁ rmation of
Heterozygous Mutants
2.7. PCR Reaction
to Amplify
the Mini-blaster
Cassette
for Disruption
of Second Allele

232 Mini-blaster-Mediated Gene Disruption in C. albicans
  Use reagents in Subheading  2.4 , but use the heterozygous
yfg1::dpl200/YFG1  strain as the transformation recipient instead of
YFG1/YFG1  strain BWP17.
      1.    YPD + Uri (80 μ g/mL) liquid medium (see Subheading  2.4 ,
item 3).
    2.    TENTS: 1% SDS, 2% Triton X−100, 0.1 M NaCl in 1× TE,
ﬁ lter sterilized.
    3.    Acid washed beads (425–600  μ m), sterilized by autoclaving.
    4.    Phenol/chloroform/isoamyl alcohol (25:24:1, v/v).
    5.    Ethanol.
    6.    1× Tris–EDTA (1× TE), pH 7.4.
    7.    10 mg/mL RNase.
    8.    10 M NH
4
OAc.
      1.    10  μ M comp forward primer (CF).
    2.    10  μ M comp reverse primer (CR).
    3.    10×  Ex Taq  Buffer PCR buffer (contains 20 mM Mg
2+
).
    4.    dNTPs (2.5 mM each).
    5.     TaKaRa Ex Taq™  DNA polymerase.
    6.    Genomic DNA: Reference strain (see  Note 1 ).
      1.     S. cerevisiae  BY4741 Δ  trp strain  (  7  ) .
    2.    YPD plates ( see  Subheading  2.4 ,  item 2 ).
    3.    YPD liquid medium ( see  Subheading  2.4 ,  item 3 ).
    4.    pDDB78 plasmid  (  6  ) .
    5.    PCR product: wild−type gene ampliﬁ ed using complementa−
tion primers.
    6.    Restriction Enzymes  Not I and  Eco RI (New England Biolabs).
    7.    10× NE Buffer 3 (New England Biolabs).
    8.    100× BSA (New England Biolabs).
    9.    Calf thymus DNA (~10 mg/mL).
    10.    PLATE: 8 mL 50% PEG
3350
  + 1 mL 10× TE + 1 mL 1 M LiOAc.
    11.    CSM−TRP plates: 2% glucose, 0.67% yeast nitrogen base (with−
out amino acids), 0.074% of CSM−TRP dropout medium, 2%
bacto−agar.
    12.    CSM−TRP liquid medium: 2% glucose, 0.67% yeast nitrogen base
(without amino acids), 0.074% CSM−URA dropout medium.
2.8. Transformation
of the Mini-blaster
Cassette into
Heterozygous
C. albicans Recipient
2.9. Preparation
of C. albicans
Genomic DNA
2.10. PCR
Ampliﬁ cation of Gene
of Interest Using
Complementation
Primers
2.11. Construction
of Complementation
Plasmid
by Homologous
Recombination
in Saccharomyces
cerevisiae and
Plasmid DNA
Recovery by
Mechanical Disruption

24 S. Ganguly and A.P. Mitchell
    13.    Plasmid DNA Miniprep Kit (Fermentas GeneJET™ Plasmid
Miniprep Kit).
    14.    Acid washed glass beads (size: 425–600  μ m).
      1.    Chemically competent  E. coli.
    2.    LB + Ampicillin (100 μ g/mL) plates (see Subheading  2.2 ,
item 1 ).
    3.    Plasmid DNA Miniprep Kit (Fermentas GeneJET™ Plasmid
Miniprep Kit).
      1.     C. albicans  homozygous Ura− mutants.
    2.    YPD + Uri (80 μ g/ μ L) plates ( see  Subheading  2.4 ,  item 2 ).
    3.    YPD + Uri (80 μ g/ μ L) liquid medium ( see  Subheading  2.4 ,
item 3).
    4.    Restriction Enzyme  Nru I (New England Biolabs).
    5.    10× NE Buffer 3 (New England Biolabs).
    6.    LATE: 0.1 M LiOAc in 1× TE buffer.
    7.    Calf thymus DNA (~10 mg/mL).
    8.    PLATE: 8 mL 50% PEG
3350
  + 1 mL 10× TE + 1 mL 1 M LiOAc.
    9.    CSM−HIS plates: 2% glucose, 0.67% yeast nitrogen base
(without amino acids), 0.077% CSM−URA dropout medium,
2% bacto−agar, 80  μ g/ μ L uridine.

The methods that follow describe a gene disruption procedure in
C. albicans  in a step−by−step format. We begin with a description of
the primer design procedure to be used to amplify the recyclable
mini−blaster cassette. This cassette will be transformed into a
C. albicans  reference strain to integrate by homologous recombi−
nation and consequently replace both of alleles of a speciﬁ c gene of
interest in sequential steps (Fig.  2 ). We will follow up with a detailed
protocol to describe recycling of the cassette and a subsequent
detection strategy to conﬁ rm the deletion of both alleles in an
unmarked homozygous deletion mutant.
      1.    Refer to the CGD website (  http://www.candidagenome.org/    )
to retrieve the coding sequence of your gene of interest plus
250 bp upstream of the start codon and 250 bp downstream of
the stop codon.
    2.    For generating primer set 1, use 100 bp of noncoding sequence
upstream of the start codon and add the adapter sequence at
2.12. E. coli
Transformation
2.13. Transformation
of Complementation
Plasmid in C. albicans
3. Methods
3.1. Primer Design

252 Mini-blaster-Mediated Gene Disruption in C. albicans
the 3 ¢  end to generate the forward primer of set 1 (F1; see
Subheading  2.1 ). For the corresponding reverse primer, use
100 bp of noncoding sequence downstream of the stop codon
(reverse complement) and add the adapter sequence at the 3 ¢
end to generate the reverse primer of set 1 (R1;  see
Subheading  2.1 ). These primers will be used to delete one
copy of the gene of interest to generate a heterozygote.
    3.    For generating primer set 2; use 100 bp of coding sequence
downstream from the start codon and add the adapter sequence
at the 3 ¢  end to generate the forward primer of set 2 (F2). For
the corresponding reverse primer, use 100 bp of coding
sequence upstream of the stop codon (reverse complement)
and add the adapter sequence at the 3 ¢  end to generate the
reverse primer of set 2 (R2) ( see   Note 2 ).
    4.    For generation of detect primers: Design a forward detect
primer 150–300 bp upstream of the start codon (FD1). A cor−
responding reverse detect should be designed 150–300 bp
downstream of the stop codon (RD1). Design an internal
gene−speciﬁ c forward primer (FD2) in the region 50–300 bp
upstream of the stop codon.
Grow in non - selective media
then plate on 5 - FOA plates~10
–4
Disrupt the other allele using mini
blaster cassette amplified using F1-R1
or F2-R2
URA3YFGYFG1YFG1
F1
R1
Mini-blaster cassette
YFG1
Select on CSM-Ura
URA3YFG1
Fig. 2. Schematic showing the mini-blaster cassette from the plasmid pDDB57. Outcomes
of subsequent transformation events are indicated step-wise in the ﬁ gure. Dotted lines
indicate the 100-bp long regions in the primer sequences bearing homology to the gene
locus of interest ( YFG1 = Y our F avorite G ene 1).

26 S. Ganguly and A.P. Mitchell
    5.    For generation of complementation primers, refer to the CGD
website to retrieve the full coding sequence of the gene of inter−
est plus 5 ¢  and 3 ¢  noncoding regions. Typically, ~1,500 bp of 5 ¢
noncoding sequence and ~300 bp of 3 ¢  noncoding sequence
are sufﬁ cient to cover the promoter and terminator sequence,
respectively. This may vary depending on the intergenic distance
and the orientation of the neighboring genes. Design primers
covering the entire above retrieved sequence using the Primer
3 software (  http://frodo.wi.mit.edu/primer3/    ). To the forward
and reverse primers designed using the software, add the fol−
lowing adapter sequences (these 40−mer sequences ﬂ ank the
Not I and  Eco RI restriction site in the pDDB78 vector, Fig.  6 )
at the 5 ¢  end to give the following primers:
    1.    Comp forward (CF): TTCACACAGGAAACAGCTATGAC
CA TGATTACGCCAAGCT + primer 3 forward sequence.
    2.    Comp reverse (CR): TCGACCATATGGGAGAGCTCCC−
AACGCGTT GGATGCATAG + primer 3 reverse sequence.
      1.    Streak out  E. coli  strain AMB900 (contains plasmid pDDB57)
and AMB906 (contains plasmid pDDB78) on LB + ampicillin
(100  μ g/mL) plates to give single colonies. Incubate over−
night at 37°C. Pick and grow a single colony of each in 5 mL
of LB + ampicillin (100  μ g/mL) liquid medium overnight.
    2.    The next day, spin down the cultures and extract plasmid DNA
using the Fermentas GeneJET™ Plasmid Miniprep Kit ( see
Note 3). Store both plasmid preps at −20°C until use. The
plasmid pDDB57 can be diluted 1:50 to serve as template for
subsequent PCR ampliﬁ cation steps.
      1.    A typical PCR reaction composition to amplify the cassette
from the plasmid pDDB57 is listed below (see  Note 4 ):
  10× PCR buffer      5  μ L
  5 mM dNTPs     4  μ L
  10  μ M forward primer (F1)       1  μ L
  10  μ M reverse primer (R1)       1  μ L
  Takara  Ex Taq ™ polymerase       0.5  μ L
  pDDB57 template (1:50)      1  μ L
  dH
2
O     37.5  μ L
  Total volume    50  μ L
    2.    The PCR program is listed below (see  Note 5 ):
  Step 1    94°C for 5 min
  Step 2    94°C for 1 min
  Step 3    56°C for 2 min
3.2. E. coli
Transformation,
Plasmid Extraction,
and Puriﬁ cation
3.3. PCR Ampliﬁ cation
of the Mini-blaster
Cassette

272 Mini-blaster-Mediated Gene Disruption in C. albicans
  Step 4    72°C for 3 min
  Step 5    Repeat steps 2–4 30 times
  Step 6    72°C for 8 min
  Step 7    4°C/end.
    3.    Check 5  μ L of the PCR product on a 0.8% DNA agarose gel
containing ethidium bromide to conﬁ rm a size of ~2,000 bp
(Fig.  1 ). Typically a smaller amplicon of ~750 bp is also
detected, representing loss of the URA3 insert due to cross−
priming on the direct repeats. Store the PCR reaction at −20°C
until use.
      1.    Streak out  C. albicans  strain BWP17  (  5  )  for single colonies on
a YPD + Uri plate (see  Note 6 ). Grow at 30°C for 2 days.
    2.    Culture a single colony in 5 mL YPD + Uri liquid media. Incubate
overnight at 30°C with agitation until the culture is saturated.
    3.    The following day, dilute the cells to 1:200 in 50 mL YPD + Uri
liquid media. Typically, this corresponds to an OD
600
  = 0.2 on
our spectrophotometer.
    4.    Incubate the diluted culture at 30°C for 4–5 h for the cells to
undergo two doublings. This would correspond to an
OD
600
  = 0.8 if the starting OD
600
  was 0.2 (see Note 7).
    5.    When the  C. albicans  culture has reached OD
600
  = 0.8 , pour it
into a 50 mL conical tube, and spin at low speed (~1,000 ×  g )
for 5 min.
    6.    Discard the supernatant, and wash the cell pellet by gently
resuspending it in 5 mL sterile dH
2
O (do not vortex).
    7.    Spin at low speed for 5 min, and discard the supernatant.
    8.    Resuspend the cell pellet in 500  μ L of LATE.
    9.    To set up  C. albicans  transformation reactions, add the
following:
      LATE cell suspension    100  μ L
  Calf thymus DNA    10  μ L
  PCR reaction from Subheading  3.2     25  μ L
    10.    Mix gently.
    11.    Incubate for 30 min at 30°C.
    12.    Add 700  μ L of freshly made PLATE, and incubate overnight
at 30°C ( see   Note 8 ).
    13.    Heat shock the cell mixture at 44°C for 15 min.
    14.    Spin cells down for 30 s at low speed, and aspirate the
supernatant.
    15.    Wash the cell pellet by resuspending in 1 mL YPD + Uri.
3.4. Transformation
of the Mini-blaster
Cassette into
C. albicans

28 S. Ganguly and A.P. Mitchell
    16.    Spin cells down for 30 s at low speed, and decant the
supernatant.
    17.    Resuspend the cells gently in 100  μ L YPD + Uri, and spread on
CSM−Ura plates.
    18.    Grow for 2 days at 30°C.
    19.    Pick 12 colonies from each transformation plate, streak for
singles on CSM−Ura plates, and incubate for 2 days at 30°C.
These transformants should be heterozygous mutants.
      1.    Pick a single colony of each of the 12 transformants ( see
Subheading  3.4 ,  step 19 ) and inoculate in 2 mL YPD + Uri
liquid media.
    2.    Grow at ~20–24 h at 30°C with shaking.
    3.    Take 50  μ L of the overnight culture solution and plate onto
CSM−URA + 5FOA ( see   Note 9 ) plates.
    4.    Incubate for 2 days at 30°C.
    5.    Pick one colony from each plate and streak for singles on
YPD + Uri plates.
    6.    Grow for 2 days at 30°C. These strains should include heterozy−
gous mutants ( yfg1::dpl200/YFG1 ) as well as mitotic recombi−
nants that have become homozygous for the non−disrupted
allele of the gene ( YFG1/YFG1 ).
      1.    Colony PCR from single colonies using 2 primers. An example
of a typical colony PCR reaction is listed below:
  10× PCR buffer      5  μ L
  5 mM dNTPs      4  μ L
  10  μ M forward detect primer (FD1)     1  μ L
  10  μ M reverse detect primer (RD1)     1  μ L
  dH
2
O     38.0  μ L
  Total volume    49.0  μ L
    2.    Add a single colony to the PCR mixture. Retain some cells
from each of the colony to be tested so that it can be further
processed if the desired PCR results are obtained.
    3.    Before adding the tubes to the PCR block, start the program
and pause it at the ﬁ rst step at 94°C. When the block has
reached 94°C, place the tubes containing the PCR mixture
and the colony over the block. Allow the thermocycler to boil
the colony at 94°C for 5 min.
    4.    Pause the reaction again and add 1.0  μ L of Taq DNA
Polymerase to each tube.
    5.    Unpause the program again and let it run to completion ( see
Note 10 ). A typical PCR program is as follows:
3.5. URA3 Marker
Excision by
Recombination
3.6. Conﬁ rmation of
Heterozygous Mutants

Another Random Scribd Document
with Unrelated Content

Claudio sorride: il sorriso solito per la solita frase udita mille e mille
volte. E Grazia presenta: suo fratello, Rosetta, i suoi grandi amici —
che stretta di mano stile Louis XV dà il conte Spada e che shake-
hand da spezzare il braccio al maestro dà don Giovannino! — e,
finalmente, le sue amiche. E, ad una ad una, le ragazze passan
davanti al maestro con un piccolo goffo inchino che le fa diventar
tutte rosse e poi si ritraggono e fanno qua e là, nel fondo in
penombra della gran sala, gruppi chiari e chiacchierini che son per
Claudio Arceri tutti sguardi e commenti.
E poi, appena Claudio è seduto accanto a Marcello che lo interroga
sul suo lavoro e sui suoi propositi, le ragazze, chiamate da Grazia,
vengono avanti e l'aiutano a servire il tè. In un angolo don
Giovannino studia il maestro. Ora s'avvicina a tre ragazze che son
rimaste lì ferme a guardare coi gomiti poggiati alla consolle. E
chiede, in confidenza:
— Meglio di me il maestro? Osereste affermarlo?
Una risata delle ragazze gli risponde e rimane lì, come uno stupido,
mentre le ragazze volan via anche loro verso il maestro, per servire i
biscotti...
E don Giovannino si consola. Guarda il maestro, vestito
semplicemente d'una giacca nera. E guarda, invece, il suo tight:
— Si fan forse le visite in giacca?... Ma bisogna compatirlo...
Poverino! È un artista. E non conosce gli usi...
XVII.
CAMPANE CHE ASPETTANO.
Come ogni sera a quell'ora, il vecchio amico del campanile aspetta
Grazia lassù per suonare l'Ave Maria. Il sole è già laggiù, su l'orlo
dell'orizzonte. Già non è più interamente un disco. E tra le grandi
campane mute, brune sul cielo verdino, il campanaro attende.
Guarda l'ora ogni due minuti. Per la prima volta quella sera Grazia è

in ritardo... E guarda giù se Grazia venga... Guarda, aspetta... E le
campane aspettano... E, il sole continua a calare laggiù, fra quelle
nuvole rosse...
XVIII.
IL «LAMENTO DI GIULIETTA».
Claudio Arceri è alla spinetta. Grazia gli ha detto:
— Vi suonò, l'ultima volta, mio padre. Vuol darmi lei la gioia di
riaprirla oggi?
Appena seduto, Claudio è rimasto incerto. Che cosa suonare? E
Grazia ha preso lo spartito d'una sua opera: Giulietta e Romeo. L'ha
aperto sul leggìo:
— Il “Lamento di Giulietta„, maestro. È il suo capolavoro!
E Claudio Arceri ha cominciato a suonare. Grazia è appoggiata alla
spinetta, intenta ad ascoltare, a guardare. E lentamente,
pianamente, a mano a mano che il maestro suona, i gruppi sparsi
nell'ombra del salone si avvicinano, si stringono sempre più,
diventano uno solo e le ragazze, le rose rosee, le rose azzurre, non
sono più staccate, ma formano adesso, chiare di luce nella
penombra, tutto un grande bouquet. E le braccia si allacciano, e gli
occhi si cercano. E Grazia guarda il piccolo orologio che ha al polso
e, mentre ascolta la musica, ricorda...
XIX.
LA BUONA NOTTE AL SOLE.
Sagoma nera su l'alto del campanile, il vecchio poeta delle campane
ha perduto oramai ogni speranza. Sarà solo, quella sera, a dar la
buona notte al sole, al sole che laggiù, nell'orizzonte ora violetto,
non è più che un piccolo arco rosso sempre più piccino, prossimo a

scomparire... E le grandi campane mute, brune sul cielo verdino,
aspettano ancora, ancora un momento...
XX.
ESTASI E RIMORSO.
E, nella sala in cui l'ombra diviene sempre più nera e dove, nella
suggestione della musica, cuori e corpi si fanno sempre più stretti e
più vicini, Grazia guarda ancora l'orologio al suo polso. Vorrebbe
andare. Non sa staccarsi. È combattuta e divisa, tra un'estasi e un
rimorso.
XXI.
AVE MARIA!
E il sole è scomparso. Pace e melanconia infinita del crepuscolo. Ed è
l'armento che torna dal pascolo col suo pastore, ed è il piccolo lago
che s'addormenta tra le ninfee, ed è la luce che s'accende nei
casolari, ed è l'ombra che scende giù per la montagna, ed è la falce
di luna che spunta lassù dietro la collina, ed è il carro pesante e
lento che va per la lunga via crepuscolare, ed è l'argenteo saluto dei
campanili lontani al giorno che se n'è andato.
E, finalmente, nere e gigantesche sul cielo ove s'accendono pallide le
prime stelle, le campane lentamente si muovono.
Presso la spinetta Grazia, d'improvviso, le ode. Tende al richiamo
lontano delle amiche d'ogni sera l'orecchio ed il cuore. Ancora è
combattuta, ancora è divisa, presa fra due sentimenti e fra due
musiche. Con gli occhi intenti, dilatati, rivede le cose d'ogni sera: il
poeta sul campanile, le ultime nuvole paonazze laggiù, le finestre di
Collina Verde che s'illuminano, la porta del casolare che si chiude, il
contadino che torna coi suoi buoi, le fanciulle che ballano su l'aia al
suono della fisarmonica.

Claudio Arceri suona. Gli occhi fissi su lui, tutta l'anima in lui, Grazia
lo ascolta. Come, nell'ombra che ha invaso tutta la stanza, che ha
disperso ogni sagoma, come il gruppo di quelli che ascoltano s'è
stretto attorno al musicista nel breve cerchio di luce gialla delle
candele!... E nel silenzio immenso solo quelle due voci si chiamano,
si rispondono, fan di due canti lo stesso canto: la spinetta di Claudio
Arceri e, lontane e lente, le campane dell'Ave Maria.
Grazia, al riflesso delle candele che illumina solo il suo volto, è lì,
appoggiata alla spinetta, il capo fra le mani, gli occhi intenti sul
musicista, il cuore alle due musiche. Ma a poco a poco una sola
musica, quella che ha vinto, rimane in tutt'il suo immenso cuore
gonfio di commozione: quella di Claudio che continua a suonare
mentre le grandi amiche d'ogni sera, che hanno invano chiamato
Grazia, si addormentano pian piano negli ultimi rintocchi sempre più
lenti e, ferme oramai, non sono più che gigantesche ombre sul cielo
sereno e infinito dell'immensa notte finalmente discesa...
XXII.
COSÌ, OGNI GIORNO...
Le parole ardenti di Cirano hanno vinto il cuore di Rossana. Lassù, al
davanzale, trepida fra i rami del gelsomino, la fanciulla è pronta, è
offerta al bacio del suo innamorato. E Cirano, escito dalla sua folle
ebbrezza, spinge su l'altro, Cristiano, a cogliere su quelle labbra
frementi il bacio ch'egli ha preparato.
Questa è la pagina ardente e disperata che oggi ispira Claudio Arceri
seduto a comporre al suo tavolino da lavoro. Ha provato or ora, al
piano, la melodia che gli è frullata nel cervello e che ha fissata su la
carta. Ora è stanco. Ha guardato sul tavolino il piccolo orologio che
segna le ore della sua fatica quotidiana. Le sue piccole amiche sono
oggi in ritardo? Ma no... Ecco il rumore d'una porta che s'apre, ecco
un echeggiar di voci, fuori, nel vestibolo, e le due amiche, tutta
azzurra l'una, tutta rosea l'altra, entran correndo e son di volo alla
scrivania e al pianoforte. Grazia cerca fra le carte, vede la nuova

musica appena appena composta. L'apre sul leggìo e, costretto
Claudio a levarsi, lo fa sedere al pianoforte. Presto, presto... Le
nuove melodie appena nate devono avere le loro prime ammiratrici.
E Claudio Arceri suona alle due piccole amiche che, sedute accanto a
lui, un gomito sul ginocchio, il volto nella mano, vedono ripassare
nella loro memoria, nel sortilegio della musica, le scene e le figure
del bel poema: l'incontro coi cappuccini, l'apparir di Rossana al
balcone, il primo balbettìo di Cristiano, il volo lirico di Cirano,
l'apologia del bacio:
.... Ma poi che cosa è un bacio? Un giuramento fatto
un poco più da presso, un più preciso patto....
XXIII.
GENTE CHE ASPETTA INVANO.
Su la poltrona dov'è inchiodato dalla paralisi il «grande malato»
volge invano il capo verso il cancello del suo piccolo giardino...
Nel laboratorio le «manine d'oro» lavorano... La tovaglia per l'altar
maggiore, tutta piena di bei ricami, è pronta, ma nessuno viene a
ritirarla. Il lavoro non è più come prima, sicuro, felice... Di tanto in
tanto le «manine d'oro» si fermano... A questa sarebbe necessario
un consiglio... Quella ha paura di sbagliare... Quell'altra non sa più
come andare avanti. E aspettano, le manine d'oro, di sera in sera, di
mattina in mattina... Aspettano.
E lì, al sole, i due ragazzoni mutilati, i due eroi, senza gambe l'uno,
senza braccia l'altro, fumano e ricordano... Ricordano le ore in cui le
parole buone, parole consolatrici, parole che nessuna altra bocca sa
dire, scendevano sino in fondo alle loro anime... Ora fumano, soli,
melanconici, al sole... Soli: come e quanto si sentono soli!... Davanti
a loro è la strada bianca, vuota... Suonava un tempo, d'improvviso,
su quella strada, il trotterello leggero e frettoloso... E tutt'il cuore era
un'illuminazione...

E, al ponticello di legno, gli erranti, i vagabondi della strada maestra,
si raccolgono come ogni mattina. Facevan chilometri e chilometri,
una volta, per non mancare all'appuntamento. Dovunque fossero,
ovunque li conducesse il loro vagabondaggio, lì li riconduceva,
all'uscir da ogni notte, la loro buona stella. Veniva di lassù, dall'alto
di quel ponticello, la buona stella, in un dondolìo di sonagli
d'argento...
E lassù, sul campanile, accanto alle immobili campane che sembrano
non aver più lo stesso suono, il poeta del campanile aspetta, guarda
ogni sera, giù giù fin dove il viottolo si perde tra i vigneti, guarda se
la piccola cara ombra appaia ancora come appariva, fedele,
puntuale, ogni sera.
Ma Grazia non viene più.
XXIV.
UN MAZZO DI ROSE BIANCHE.
Claudio ha richiuso il piano. Quanta ne vorrebbero le ragazze!...
Vorrebbero uno spartito al giorno... Ma musica nuova non ce n'è
più... Grazia non si fida. È alla scrivania. Rovista fra le carte. Son lì,
nel vaso di cristallo, le belle rose rosse. Sono le rose che ella gli
manda ogni mattina per fiorirne il suo tavolino da lavoro. Ora Grazia
tuffa il viso, in quelle foglie ardenti e fresche: e, tra quelle foglie, il
suo respiro è quasi un bacio. Ma, volgendosi, Grazia vede un altro
mazzo di rose — bianche queste — lì, in un altro vaso di cristallo, sul
pianoforte. Un'ombra passa sul suo volto e spegne il suo sorriso.
— E queste? ella chiede.
Come, prima che Claudio risponda, Rosetta, tutta rossa, abbassa il
volto confusa e mortificata! È perfettamente inutile che il maestro
spieghi:
— Son della signorina Rosetta...

.... Già Grazia, da quel rossore, dall'abbassarsi di quello sguardo sul
tappeto, l'aveva capito... Lo sguardo di Grazia non s'abbassa come
quello della sua amica. Fattosi oscuro e torbido riman lì, diritto,
fermo. Rosetta se lo sente addosso senza vederlo e ne ha fastidio.
Con un pretesto si allontana con Claudio verso il fondo della stanza
dove son giornali e riviste appena arrivati con la posta. E Grazia,
sempre fermo e diritto lo sguardo carico di nuvole nere, strappa non
veduta qualche foglia al mazzo di rose bianche di Rosetta e le
stritola, le stritola — come le stritola! — nelle sue piccole mani
convulse...
Claudio prepara il tè, laggiù, in fondo. Rosetta, che è buona e che
non ha nulla da rimproverarsi, si è riavvicinata a Grazia: timidamente
le chiede che cosa abbia. Le risponde una spallucciata.
— Che ho? Nulla.
Non ha nulla. E ha tutto. Ha un turbamento profondo che non ha
forma, che non ha nome ancora, ma che la lascia lì, imbronciata,
cupa, senza farle trovare una sola parola da dire all'amica, che le
stringe il cuore sino a farglielo così piccino che entrerebbe in un
pugno. E rimangon lì, così, le due donne — così vicine e così divise
— finchè Claudio s'accosta a loro recando due tazze di tè.
Ma passa ogni nube, tornano il volto e l'anima di Grazia a sorridere
se Claudio, bevuto il tè, siede con le due fanciulle in un angolo del
salotto e parla di sè, parla di sè a loro che bevono intente le sue
parole, parla, come lui solo sa parlarne, dei suoi ricordi d'arte e dei
suoi sogni di gloria.
XXV.
QUANDO GRAZIA NON C'È...
— Chiudete le finestre. Ho freddo.
È primavera. Ma Marcello ha freddo. Non c'è sole che gli illumini il
buio dell'anima, non c'è tepor di maggio che gli riscaldi le vene. È lì,

sconsolato, freddoloso, sotto le coperte, disteso sul divano, fra i due
più vecchi domestici di casa che lo assistono, la vecchia cameriera
che lo ha visto nascere e il vecchio servo fedele che gli è così vigile e
affettuoso infermiere. Un tempo una cosa, una gran cosa, riesciva a
distrarlo dal pensiero del suo male, a infondergli coraggio: il sorriso
di Grazia, la continua presenza di Grazia. Ma ora... Come son lunghe
e come son tristi a passare le ore in cui ella è lontana... E come in
quelle ore tutt'i suoi mali sembrano moltiplicarsi...
— Chiudete... Chiudete ancora... Ci dev'essere qualche cosa d'aperto
nell'altra stanza... Ho freddo...
Ha freddo dentro e gli pare d'aver freddo fuori. E con le coperte di
cui s'avvolge crede di riempire il vuoto, di rimediare al freddo che
Grazia lascia, quando non c'è...
XXVI.
CHI È LA MUSA?
Sono in giardino, tra le più belle rose del mondo. Son veramente le
più belle? Così almeno sembrano a loro. Così sembra a loro tutto
quello che da vicino o da lontano circonda il musicista, appartiene
comunque a lui o alla sua vita.
Rosetta chiede l'ora. La sua istitutrice doveva venirla a prendere alle
quattro e son le quattro passate da un pezzo. Ma chi pensa più
all'ora, al ritardo, alla mamma che aspetta, adesso che Claudio
prende a ognuna delle due ragazze una mano e sollevandole in alto
domanda con un sorriso:
— Qual'è fra voi due la Musa?
L'idea tenta Grazia immediatamente. In un lampo la coglie, ne fa un
fatto. Ha tolto dal taschino di Claudio il suo fazzoletto e ha bendato il
musicista. E ora, allontanandosi da lui e allontanando con sè
Rosetta, lasciandolo lì in mezzo alla grande aiuola fiorita, gli grida:
— Scegliete.

Strano giuoco frivolo e terribile in cui le bimbe che sono state fino a
ieri si divertono un mondo e non vorrebbero mai farsi acchiappare
da Claudio che, qua e là, le insegue, e in cui le donne ch'esse sono
diventate trepidano in una tensione atroce dello spirito e vorrebbero
che sùbito Claudio riuscisse ad afferrarle, che immediatamente il
giuoco finisse e la sorte facesse la sua scelta come a fissare e a
scoprire il destino. E vanno, e girano, e fuggono, e ritornano, e lo
sfiorano, e lo toccano, e son lì a due passi, e son là lontane, e
Claudio crede di stringerne una fra le braccia, e abbraccia l'aria fra le
loro risate. Ma, ahi, è fatta... Questa volta è presa bene e non
scappa più... Una delle due fanciulle è nelle braccia di Claudio che
sùbito si sbenda e la vede:
— Voi! Grazia!
E, tra il giuoco e il serio, Claudio trattiene per qualche istante fra le
sue braccia, più che non dovrebbe, Grazia, il cui volto è tutto
illuminato di gioia, mentre Rosetta s'è fatta laggiù, dove il viale
comincia, per nascondere il suo turbamento, per vedere se giunga la
sua istitutrice, la sua istitutrice che è incredibilmente in ritardo. E
ancora Claudio a bassa voce mormora all'orecchio di Grazia che tutta
ne trema e abbassa il volto fatto di brace:
— Voi... Voi...
XXVII.
GLI ABBANDONATI.
Su la piazza del paese, al piccolo “gran caffè„, mogi mogi,
abbandonati, senza parlare, son seduti tre dei quattro amici di
Grazia: il conte Spada, il farmacista e il maestro. Qua e là per la
piazza, su la porta delle case, le belle ragazze di Collina Verde fan
capannelli. E don Giovannino, più che mai fatale, va di gruppo in
gruppo, a dispensar sorrisi e a rubar cuori. Ma chi lo guarda più don
Giovannino da quando c'è in paese Claudio Arceri? Son tutte lì, su le
porte, per aspettarlo, per vederlo passare, alla solita ora, alle cinque,

quando viene in paese a spedir la sua posta e a comprar sigarette.
Ora che c'è in paese un grand'uomo e un bell'uomo chi guarda più,
chi può più guardare quell'uomo ridicolo ch'è don Giovannino? Ma
don Giovannino, come tutti i grandi che decadono, non si accorge
della sua decadenza. Prende per buoni i sorrisi ironici che lo
accolgono, chiude le orecchie alle risate che lo seguono, vede solo la
più santa ingenuità nelle frasi piene di malizia e di scherno con cui le
belle ragazze di Collina Verde prendono in giro la sua fatalità
esautorata e si burlano, insomma, maledettissimamente di lui...
Accanto ai tre che non parlano, caduti nell'abbattimento profondo
dei grandi abbandoni, il medico prende un caffè. Ma il domestico di
Grazia viene a chiamarlo.
— Corra, corra signor dottore... Il signor Marcello sta male... Ed io
vado al Castello a chiamare sùbito la signorina Grazia...
E corre via, pover'uomo, nel suo affanno e nel suo affetto, come se i
suoi vecchi «piedi dolci» avessero le ali...
XXVIII.
L'«ARIA DEL BACIO».
Quella Grazia non fa che rovistar tra le carte di Claudio! Rientrati
nello studio e mentre Claudio e Rosetta sono occupati a sfogliare un
album di fotografie, Grazia si è avvicinata al tavolino per frugare
ancora. Non è, del resto, diritto della Musa ficcare il nasino nelle
faccende del suo Poeta? E, cerca, cerca... ha trovato! Ha trovato un
brano che Claudio non aveva ancora confessato d'aver composto.
Ora, con un lieve cenno, non veduta da Rosetta che continua a
guardar fotografie, ha chiamato Claudio per mostrargli il foglio di
musica e dirgli:
— Questa, “l'aria del bacio„, dovete farla sentire a me sola....
E Claudio le risponde sorridendo, sottovoce, e rimettendo il foglio sul
tavolino:

— Sì... Più tardi... Quando Rosetta se ne sarà andata...
Uff!... Ma quando se ne va Rosetta?... È sempre laggiù, a guardar
fotografie, tranquilla... Che può mai trovare d'interessante in un
album di fotografie di gente che non conosce?... Sempre così, quella
ragazza... Senza nervi, docile come una pecora... Se le dicessero di
star lì tre ore a leggere e le mettessero fra le mani l'Indicatore
generale delle Ferrovie, lo leggerebbe tutto, da cima a fondo... Per la
prima volta Grazia è severa con la sua amica... Ma anche lei... Che
ostrica attaccata allo scoglio... La lasciasse mai sola.... E Grazia
guarda al suo polso il piccolo orologio: le quattro e mezza...
— Non doveva la tua istitutrice venirti a prendere alle quattro?... Sai
che son già le quattro e mezza passate?
Rosetta s'è levata chiudendo l'album... Oh, finalmente.... Guarda
dalla finestra per vedere se l'istitutrice venga... Oh, un passo nel
giardino... Eccola... Ma no... È un uomo, è il domestico di Grazia, che
vuol parlare a Grazia... E le parla, in un angolo, sottovoce:
— Venga sùbito, signorina... Il signor Marcello non sta bene... E la
vuole...
Sùbito Grazia è in allarme: pallida, tremante... Il suo primo
movimento è per andarsene... Ma guarda, lì, verso la finestra... Vede
Rosetta e Claudio, vicini, vicinissimi, che parlano, che ridono... Che
fare? Lasciarli soli?.. E il piccolo delitto si compie nell'anima sua. Non
chiede al domestico di più per non sapere di più... Gli dice che andrà
sùbito e, con un gesto, lo congeda. Poi risale verso i due che
vengono incontro a lei per interrogarla:
— Forse Marcello?...
E Grazia, la voce fredda, e decisa:
— Nulla... Nulla...
Sente, Grazia, tutto il suo delitto, ma lo compie, irresistibilmente,
inevitabilmente. Non può staccarsi. È lì, inchiodata, nel suo martirio
e nel suo amore. E c'è qualche cosa di più della gelosia per non farla
muovere. C'è l'amore per non farla andare via. Ora l'istitutrice di

Rosetta è entrata e Rosetta è pronta per andarsene. Ora non c'è più
la sofferenza di lasciarli soli, lì, accanto alla finestra, vicini,
vicinissimi, a parlare, a ridere... Rosetta, gelosa anche lei, le dice:
— Vieni anche tu?
Ma Grazia, l'aria ingenua, gli occhi bassi, quasi con un fare annoiato
di dover restar lì per non saper dove andare, risponde:
— No... Rimarrò... Ancora un poco...
A malincuore Rosetta va via. Claudio l'accompagna, fuori, in
giardino. Per la prima volta da che si conoscono e si vogliono bene le
due amiche non si sono baciate separandosi. Grazia, senza più forze,
s'è appoggiata, rigida, contro il muro. È lì, inchiodata, e la visione le
appare della sua casa, di Marcello disteso sul divano, nelle torture
atroci del suo male, nella terribile crisi... E quando Claudio rientra la
trova così: rigida contro il muro, pallida con gli occhi sbarrati.
— Che avete?
Ma non ha nulla, nulla... Non si allarmi... Nulla... E va al pianoforte,
e prende il foglio di musica, e lo mette sul leggìo... E fa sedere
Claudio, e siede accanto a lui, di contro a lui, a guardarlo, ad
ascoltarlo... Com'è deliziosa, avvolgente suggestiva quella musica...
Come si fa leggera, arguta, preziosa per il concettino lezioso,
leggiadro e artificiale che definisce il bacio:
.... un apostrofo roseo messo tra le parole
t'amo...
E come più oltre la musica si fa appassionata, ardente, travolgente,
con tutto l'ardore, con tutto il furore del bacio... Come Claudio
guarda, suonandola, Grazia... Come Grazia guarda, ascoltandola,
Claudio... Il bacio è già fra loro, aereo ancora, non tòcco, in quei due
sguardi... L'invito, la forza magnetica delle due giovinezze, è
irresistibile. Ed eccoli, quando la musica cessa, prima su l'ultimo
grido, poi su l'ultima nota ch'è un sospiro di voluttà, eccoli l'uno nelle
braccia dell'altra... Non è, ancora, il bacio delle bocche... Grazia non

vorrebbe... Claudio non osa... Ma è, irresistibile, più grande, più
profondo, il bacio delle anime che si sono intese, che comunicano...
È la gloria trepida, immensa, senza parole, dell'amore che
incomincia...
XXIX.
SOLO.
Nella stanza del malato dove già le lampade sono accese, un andare
e venire di ombre in un odore grave di farmaci. È la voce di Marcello
che geme:
— E Grazia... Grazia che non viene... Ma l'avete, l'avete veramente
chiamata?...
Ora un colpo di tosse, atroce, gli spezza il petto di fuoco. E,
ricadendo sui cuscini, il malato geme:
— Sto così male, così male... Chiamate, chiamatemi Grazia, ve ne
scongiuro...
XXX.
RITORNO.
.... e Grazia s'è levata, s'è strappata, quasi, dalle braccia di Claudio.
Lo ha fatto sedere al tavolino e prepararsi a riprendere il lavoro.
— Mi piace, da lontano, di potervi pensare così: curvo su le vostre
carte, a cercar la musica nel vostro cuore...
Ha già in capo la gran paglia di Firenze coperta di roselline. Claudio
fa per levarsi. Ma Grazia lo ferma, col gesto, con la voce:
— No, non mi accompagnate. Rimanete così...
E si allontana. Poi ritorna. Prende nel vaso di cristallo le sue rose
rosse. Le sfoglia su le pagine di Claudio da dietro le sue spalle.

Claudio le afferra una mano, vi depone un bacio e con quella la
trattiene, la tiene... Ma Grazia si scioglie dolcemente:
— No... Lasciatemi andare... È tardi... Mio fratello non sta bene... E
mi attende...
Ed esce così, indietreggiando, senza levar lo sguardo di dosso a
Claudio immobile alla scrivania. È alla porta. L'apre. Esce. Richiude.
Claudio china il volto su le pagine bianche e su le rose rosse. Poi
prende la penna. Cerca un istante, gli occhi in aria, e riprende il
lavoro...
Ma la porta si riapre, cautamente, leggermente. Claudio, assorto nel
lavoro, non ode. Grazia è rientrata così, e, in punta di piedi, cauta
cauta, leggera leggera leggera, va fino al pianoforte per prender
nell'altro vaso di cristallo l'altro mazzo di rose, le rose bianche, le
rose di Rosetta, e portarlo via con sè. E, piano piano, leggera
leggera leggera, guardando quelle rose non sue che non vuol lasciar
lì, indietreggia, raggiunge la porta, l'apre, esce, richiude, senza che
Claudio, assorto nel lavoro, si sia avveduto di nulla...
Fuori, nel giardino, Grazia distrugge con le mani febbrili le rose di
Rosetta e ne fa una pioggia bianca su le aiuole intorno. Poi si chiude
nel mantello — col suo delitto verso il fratello, col suo amore per
Claudio, con la sua gelosia per Rosetta — si chiude nel mantello e
fugge, fugge via, di corsa, di volo, per non perdere un minuto di più,
un solo istante ancora, per essere sùbito, sùbito, da Marcello, dal
povero Marcello, che ella, nella sua follìa, ha potuto... ha potuto...
Oh, orrore!... Ha potuto...
Corre... corre... Ed eccola alla sua villa, nel suo giardino, su per le
scale, nella gran galleria, alla porta della camera... Ed entra. Ma
quand'ella entra sùbito i domestici, col gesto, ne arrestano l'impeto:
— Sssss... Dorme!
E mentre il vecchio servo guarda se il sonno e il respiro son tranquilli
la vecchia domestica spiega:
— È stato tanto male... Ed ha tanto cercato di lei...

Col gesto, immobile, chiusa nel nero mantello, Grazia allontana i
servi. E, rimasta sola, si getta ginocchioni ai piedi del fratello, gli
bacia le mani e, fra i singhiozzi che le scuoton la gola, dice
disperatamente al fratello addormentato:
— Perdonami, perdonami, Marcello!
E rimane lì, piangendo sommessa, accucciata a terra, umile, pentita,
sgomenta, a passarsi sui capelli, quasi per farsi perdonare senza
attendere il risveglio, dolcemente, dolcemente, in una lenta carezza,
la mano del suo povero fratello che dorme dopo aver tanto sofferto
senza di lei...
XXXI.
«HO IO IL DIRITTO DI AMARE?»
Nella notte Grazia non ha trovato pace nè riposo. Avute nel delitto
contro il fratello la rivelazione e la certezza del suo amore, tutta la
crudeltà del suo destino e tutta la precarietà del suo bene le sono
apparse. È stata, or ora, a baciar su la fronte Marcello che dorme
nella stanza accanto alla sua. Le giunge, dalla porta aperta, il suo
respiro più calmo, eguale. Quanto deve già amare ella Claudio Arceri
se ha potuto, quel giorno, lasciar Marcello in preda al suo orribile
male senza soccorrerlo, senza volare da lui, col cuore in gola,
appena chiamata, come sempre faceva al primo, al minimo
allarme!... Ora è ferma davanti a un cassetto che ha socchiuso e da
cui ha tratto alcuni medaglioni, vecchie miniature di famiglia. Lassù,
in montagna, la notte è ancora fredda e un po' di fuoco è ancora
acceso, brace, non più fiamma, nel suo camino. E Grazia s'accuccia a
terra, in quel po' di calore, in quel po' di luce rossa. E l'atroce
domanda è nel suo cuore:
— Ho io il diritto di amare?
Guarda i medaglioni ad uno ad uno. Sua madre... Suo padre... Due
suoi fratelli... La piccola Anna Maria a quattordici anni... Morti tutti
così... Condannati tutti dal medesimo male...

E d'un balzo è in piedi, rigida, tragica, contratto il viso e disfatto, con
le mani convulse a stringere i medaglioni sul petto entro cui freme,
in un ritmo precipitoso del cuore in tumulto, la terribile domanda che
mille volte s'è fatta, che mai s'è fatta però così atrocemente come
quella notte:
— Ed io? Io?...
E ricade giù, di piombo, abbandonata da ogni sua forza, accanto al
camino, in quel po' di calore, in quel po' di luce rossa. E ricorda.
Ricorda com'ella ha vissuto finora. Si rivede errante ogni anno nei
paesi del sole, Nizza, Mentone, il Cairo; si rivede, nella calda
stagione, nei paesi delle eterne nevi dove l'ossigeno difende la vita
minacciata. Non è forse il male entro di lei? Può ella credere
d'esserne miracolosamente immune, mentre suo fratello, di là, lotta
già contro l'insidia ogni giorno, può illudersi solo perchè le cure
prudenti e una previdente igiene hanno forse ritardato il giorno
dell'aperta condanna? Può ella credere d'essere salva solo perchè ha
voluto tentar di salvarsi?
E Grazia rompe in un lungo pianto disperato, dilaniata così tra l'estasi
del suo amore e l'orrore della sua condanna...
XXXII.
NO!
Condannata? Saperlo, saperlo... La mattina dopo, con un pretesto, al
primo schiarire, Grazia è discesa, anonima, sconosciuta, alla città. È
già lì, da un'ora, nella sala d'aspetto del clinico famoso, tra gli altri
malati, altri dolori che attendono.
Grazia rivede Claudio Arceri, a quell'ora già intento al lavoro, al
tavolino dove in un vaso di cristallo son le sue rose rosse nuove ogni
mattina. E si rivede, come ieri ella era, nelle braccia di Claudio, nella
prima stretta, nella prima felicità... E invece... La giovinezza, l'amore,
la gloria... Dovere a tutto rinunziare!... Ed è lì, assorta, disperata e
muta, mentre due lacrime le appaiono su l'orlo del ciglio e le

scendon giù lungo le guance pallide, irrigidite, scarnite quasi, quella
mattina, dall'atroce tensione d'ogni nervo, d'ogni muscolo...
Ora la chiamano. È il suo turno. Ha fatto al medico la domanda
recisa:
— Voglio sapere, dottore... Posso io amare? Posso avere senza
delitto una casa, figliuoli?...
Attento, tranquillo, solito, il medico la esplora, l'ascolta. Grazia spia
ogni minimo moto del suo volto, tutta l'anima tesa, sospesa. Sul
volto indifferente e abituato del grande clinico, solo un'ombra è
passata, un istante: ma sùbito Grazia l'ha veduta, l'ha còlta. Tenta il
medico qualche menzogna:
— Vedere... Aspettare... Il tempo...
Ma Grazia disperata e umile scuote il capo. Sa che la condanna è
inesorabile e mentre si riabbottona il corpetto sussurra:
— Anche io... come gli altri...
Ancora il medico — c'è un po' di pietà anche nei cuori stoici — tenta
qualche consolazione blanda:
— Non creda questo... Può guarire.. Molte cure... La giovinezza ha
meravigliose forze di difesa... Potrà un giorno aver la sua casa anche
lei, i suoi figliuoli... Lo credo... Lo spero... Ma aspettare... Aspettare
molto tempo, certamente....
Scuote il capo ancora, Grazia, cercando nella sua borsetta il denaro
del consulto. Perchè spreca il medico quelle parole?
— No, dottore... Sapevo già... Ma prima d'oggi non ho mai voluto
sapere... con certezza... Ma oggi era necessario... Oggi non potevo,
non dovevo più illudermi...
Ha tratto dalla borsa la busta col denaro: cinquanta lire. E la rimette
al medico con un sorriso e un ringraziamento. Quanto costa poco la
verità! Una vita sa di dovere a tutto rinunziare, di dover lentamente
durare per aspettar solo la morte: cinquanta lire! La scienza, con
breve esame, uccide il sogno, l'amore, un'anima, chiude tutto un

destino... Nulla. Una piccola busta presa con un gesto indifferente...
Cinquanta lire! È la commedia atroce delle tragedie chiuse in uno
solo, delle ore tragiche con persone indifferenti... Non ostante la
condanna data e ricevuta, due sorrisi, due inchini, un
ringraziamento! E, vinta, finita, distrutta, Grazia è uscita, fuori, nella
sala d'aspetto. Le forze tese fino a quel punto non la reggono più. Ed
ella cade lì, su una poltrona, accanto alla porta che il medico ha
richiusa dietro di lei per riaprirla, fra due minuti (il tempo di segnar
l'incasso e il numero della consultazione su un registro), per riaprirla,
fra due minuti, su un'altra angoscia.
Due bambini gracili, macilenti ed un signore a lutto sono seduti
accanto a Grazia che trae a sè i due bambini e interroga il padre
toccandoli al petto:
— Malati?
E il padre, coprendosi gli occhi col fazzoletto, dice due volte col capo
di sì, di sì...
Ha fra le sue braccia, Grazia, i due bambini esangui, intimiditi e
docili.
— Così sarebbero, pensa, i miei figliuoli...
Si asciuga le lacrime, bacia i bambini e si leva. Tende una mano
pietosa — carità d'un povero a un povero, carità anonima e sublime
— al padre che piange e gli dice:
— Coraggio!
E il signore a lutto, il vedovo, stringe quella mano e vi depone un
bacio. Scuote il capo come per dire che coraggio ne ha avuto tanto,
che ora non ne ha più... E china ancora il volto nel fazzoletto che
trema nella sua mano...
XXXIII.
PICCOLA FELICITÀ DA SOLA.

Mentre Claudio lavorava Rosetta è entrata. S'è sùbito guardata
attorno, cercando, stupita...
— E Grazia?
Claudio le ha teso la lettera di Grazia: costretta da un affare urgente
a discendere in città non potrà quella mattina andarlo a salutare...
Manda il solito augurio di buon lavoro... Tornerà, certamente, nel
pomeriggio...
Rosetta ha pregato Claudio. Poichè ella è sola Claudio non le farà
l'offesa di non suonare solo per lei la musica composta quella
mattina... Come può Claudio dire di no?... Ed è al piano, e suona... E
Rosetta l'ascolta, intenta... E la musica, quella musica, le par più
bella perchè è suonata stamattina solamente per lei...
XXXIV.
SOLITUDINE AL GIARDINO PUBBLICO.
Accanto alla stazione, nel giardino pubblico ov'ella attende il treno
per ripartire, Grazia è seduta su una panchina. Attorno a lei è un
andare e venire di gente al sole della bella mattina, è un correre e
un gridare di bimbi felici. Due, tre volte gli occhi le si riempion di
lacrime nel guardare quello spettacolo di serenità, quella lieta
primavera dell'anno e della vita. Due, tre volte ha sollevato il
fazzoletto ad asciugare con rapido pudore quelle sue lacrime
pubbliche. Un bimbo, la cui palla è venuta a cadere presso Grazia, la
vede asciugarsi le lacrime. La tira per la veste e le chiede:
— Perchè piangi, signora?
E gli par così strano che ci sia qualcuno che piange lì; dove si viene
ogni mattina, quando c'è il sole, per giuocare... Interroga già, quel
bambino, come interroghiamo noi uomini: non per far dire agli altri
ciò che loro preme sul cuore, ma per sapere noi, quando siamo
curiosi... Ma il bimbo ha già in mano la palla... E, senza aspettar che

Grazia risponda, già la tira, laggiù, ai compagni di giuoco che lo
chiamano...
XXXV.
ROSE BIANCHE E ROSE ROSSE.
Ora, mentre Claudio suona, Rosetta si leva e, preso il mazzo di rose
bianche che ha portate con sè, le mette sul tavolino di Claudio dopo
aver tolto dal vaso di cristallo le rose rosse di Grazia.
E, in una pausa della musica, spiega:
— Mettiamo qui, stamattina, le rose mie.... Quelle di Grazia sono già
appassite...
XXXVI.
«MADRE, CONSOLAMI TU!»
Nel giardino del convento della Collina Verde le piccole suore bianche
sono in ricreazione. È l'ora in cui anche giuocare è malinconia. Vien
su il crepuscolo da dietro la collina. Tramonta il sole laggiù, sotto
quell'arco verde fatto dai pini, in un cielo di fiamme gialle.
Grazia è alla porticina del convento, appoggiata, esausta. Ha bussato
e aspetta. E quando la suora guardiana apre il corpo di Grazia, senza
più sostegno, cade dentro, nel convento, di piombo, come un corpo
morto, come un corpo senz'anima, fra le braccia della suora che ha
appena il tempo e che ha appena la forza di sorreggerlo...
Le altre suore sono accorse, tutte bianche attorno a Grazia tutta
vestita di nero. Mentre vanno per il gran viale dei cipressi la
sorreggono, quasi la portano. Chiedon con gli occhi trepidi alla
piccola amica che cosa ella abbia, ma la piccola amica ha chiuso gli
occhi e le labbra. Giungon così su lo spiazzo davanti alla Cappella.
Anche la Madre Badessa corre incontro a Grazia. E Grazia, le mani
giunte, le cade in ginocchio davanti:

— Madre, Madre, consolami tu, consigliami tu, col tuo Crocefisso!
E stringe nelle mani convulse, e bacia con le sue labbra frementi, il
piccolo crocefisso d'ebano e d'avorio che pende lungo la gonna della
Badessa. E questa, chiamandola appena con la voce bassa e
commossa, le carezza i capelli da cui il velo nero è caduto. Non sa
che dirle: sa che bisogna solo lasciarla piangere, così... E Grazia
piange, piange, disperata, tutta scossa dai singulti, schiantata in
tutta la sua persona e in tutta la sua vita, mentre le piccole suore,
interrotte nei loro giuochi, fatte serie, timide e silenziose da quel
dolore che vien da fuori a cercar rifugio là dove nell'accettazione
dolore non c'è più, si avvicinano a piccoli passi, senza far rumore, al
gruppo doloroso.
XXXVII.
COLUI CHE HA A TUTTO RINUNZIATO.
Pallida figura di Cristo su la grigia parete della cella ove Grazia ha
trascorso, in affannosa veglia, la notte... E, d'innanzi a Colui che
seppe a tutto rinunziare, la Badessa e Grazia sono inginocchiate
pregando.
Nella lunga meditazione notturna, con la lunga preghiera, la serenità
è ritornata nel cuore di Grazia. Il suo dolore è, adesso, pacato e
forte. Ella accetta, gravemente, eroicamente, nella speranza d'un
bene ultraterreno più tardi, la rinunzia suprema. Sollevando gli occhi
verso la Madre Badessa che, come una madre veramente, le
accarezza i capelli, Grazia sussurra:
— Rinunzio anch'io... come Lui... Porto anch'io... come lui... la mia
Croce!
Un'ultima debolezza ed ella s'abbatte piangendo su le ginocchia della
Madre. Ma questa, dolcemente, con parole che invocan la grazia, la
risolleva. E la piccola martire chiede, chiede alla Badessa, e chiede
ancor più a Lui:

— Ma come, come vincere la tentazione?... Come resistere al mio
amore?
La Badessa non risponde. Colui che ha a tutto rinunziato risponde in
fondo all'anima della fanciulla con misteriose parole. Grazia e la
Madre si son levate e sono uscite. Sono adesso nel giardino del
convento, appoggiate alla balaustra, d'innanzi all'ampio paesaggio
azzurrognolo della pianura laggiù. E Grazia dice:
— Laggiù, al piano, il sacrificio mi sembrava ieri tremendo.....
E china il capo su la spalla della Badessa che ancora, come una
mamma inconsolabile nel consolare, le accarezza dolcemente e
lentamente i capelli....
XXXVIII.
UN BIGLIETTO.
Buon lavoro quella mattina, lavoro sereno, lavoro fecondo. Il
domestico entra a portare a Claudio Arceri un mazzo di rose bianche.
C'è, insieme, un biglietto:
«Poichè Grazia lascia appassir le sue rose voglio che sul vostro
tavolino, accanto al vostro lavoro, sieno oggi, come ieri, le mie,
fresche e nuove ogni giorno.
ROSETTA».
XXXIX.
ARRIVEDERCI, SORELLE!
La mano della Madre è su la fronte di Grazia, per costringerla a
levarla in alto, a guardar lassù, verso il cielo. Pensa ancora alle
parole di Grazia: “Laggiù, al piano, il sacrificio mi pareva ieri
tremendo...„. E la Madre le dice:

— E sai perchè qui il sacrificio ti par oggi meno terribile?... Perchè
sei più vicina al cielo che promette al dolore ricompensa...
E lo sguardo di Grazia, estatico, è lassù, fisso in quelle nuvole
bianche, in quelle nuvole d'oro di cui il sole nascosto s'ammanta, in
quelle nuvole in cui le par di vedere apparire — un istante solo —
Cristo tra gli angeli...
Ma è tardi. Bisogna andare. È attesa a casa. Marcello sarà in gran
pensiero. E vanno per il gran viale dei cipressi, verso l'uscita. Grazia
ripete ancora entro di sè la sua domanda: ma come vincere la
tentazione, come resistere al suo amore?... E la luce si fa nel suo
spirito, improvvisa... Un fantasma, un cavaliere dal lungo naso
ridicolo e dal grande cuore eroico, è passato un istante, col suo
sacrificio, nel suo ricordo... Ed ella dice, soffermandosi:
— Non ho che una via di salvezza: donare ad un'altra l'amore che
avevo sognato per me...
Rivanno. Sono presso la porta d'uscita. Grazia passa tra i bianchi
gruppi di suore: qualcuna ne abbraccia, tutte saluta... E quando le
ha tutte raccolte attorno a sè ne abbraccia ancora due con un
grande gesto che tutte vorrebbe stringerle al cuore:
— Arrivederci, sorelle!
E mentre, di nuovo rompendo in lacrime, si riavvìa con la Madre
Badessa, le piccole suore bianche si guardano tra stupite e
commosse:
— Che ha?... Che ha?
E Grazia, andando, dice alla Madre, alla madre di tutte:
— Sorelle veramente... Anche fuori di qui, anche con queste mie
vesti... sono anch'io come loro... se anch'io ho a tutto rinunziato...
Nera, nascosta fra l'edera, è d'innanzi a loro la porticina del convento
che la suora guardiana ha socchiusa...
Che sole c'è, fuori, nella mattinata di maggio!... E da quante mattine
suor Ghiottona non ha più la sua cioccolata....

XL.
SERENITÀ NELLA RINUNZIA.
E, sul piazzale davanti alla cappella, al sole, tra le rose in fiore,
vanno, serene, placide e chete, le piccole suore. Quelle annaffiano i
fiori. Quelle altre ne còlgono.
XLI.
RINUNZIA NELLA TEMPESTA.
E la piccola porta del convento della Collina Verde s'è richiusa. Grazia
vi si appoggia sentendo mancar le sue forze. Ha sul volto i segni
della tremenda intima tempesta. Gli occhi sono fissi, vitrei, nel
vuoto... fissi su la terribile visione...
... Rosetta al tavolino del musicista e Claudio che sfiora, con un
primo bacio, la fronte della fanciulla...
... e Grazia ha le mani su gli occhi per fugar la visione. Poi li riscopre.
Da fissi si fanno vivi, animati empiendosi di lacrime benefiche. E, in
quel pianto silenzioso, senza singulti, il suo volto che si placa si china
lentamente sul petto, assentendo, accettando...
Poi Grazia si stacca dalla porticina del convento, s'irrigidisce,
s'innalza, si tende. Si chiude nel suo mantello nero. E così, chiusa,
ferma, incrollabile, s'avvia verso il suo destino...
XLII.
GELOSIA.
— Ho potuto fuggir di casa un momento anche stamattina...
Claudio la guarda. Sorride. Ringrazia. Com'è trepida, e ansante, la
piccina... Ma come lo spirito di Claudio, pur se ha Rosetta vicina, è

Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade
Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.
Let us accompany you on the journey of exploring knowledge and
personal growth!
ebookultra.com

Host Fungus Interactions Methods and Protocols 1st Edition Christoph Sasse

About This Presentation

Slide Content

Tags

Categories

Download

Quick Actions

Statistics

Related Slideshows

Host Fungus Interactions Methods and Protocols 1st Edition Christoph Sasse

About This Presentation

Slide Content

Slide 1

Slide 2

Slide 3

Slide 5

Slide 7

Slide 8

Slide 9

Slide 10

Slide 11

Slide 12

Slide 13

Slide 14

Slide 15

Slide 16

Slide 17

Slide 18

Slide 19

Slide 20

Slide 21

Slide 22

Slide 23

Slide 24

Slide 25

Slide 26

Slide 27

Slide 28

Slide 29

Slide 30

Slide 31

Slide 32

Slide 33

Slide 34

Slide 35

Slide 36

Slide 37

Slide 38

Slide 39

Slide 40

Slide 41

Slide 42

Slide 43

Slide 44

Slide 45

Slide 46

Slide 47

Slide 48

Slide 49

Slide 50

Slide 51

Slide 52

Slide 53

Slide 54

Slide 55

Slide 56

Slide 57

Slide 58

Slide 59

Slide 60

Slide 61

Slide 62

Slide 63

Slide 64

Slide 65

Slide 66

Slide 67

Slide 68

Slide 69

Slide 70

Slide 71

Slide 72

Slide 73

Slide 74

Slide 75

Slide 76

Tags

Categories

Download